INTRODUCTION
The formation and growth of skeletal muscles in vertebrates proceeds via successive waves or phases of myogenesis that occur during embryonic and foetal development under the influence of various intrinsic and extrinsic signals (reviewed by Buckingham, 2007; Pownall et al., 2002; Shi and Garry, 2006). Vertebrate muscles contain a spectrum of fibre types varying between fatigue-resistant slow twitch fibres with oxidative metabolism and fast twitch fibres with glycolytic metabolism for brief powerful activity. The myosin heavy chain (MyHC) isotype is a major determinant of these contrasting contractile properties (Bottinelli, 2001; Weiss et al., 2001). In a wide range of vertebrate genomes, numerous MyHC genes are organised as members of tandem arrays or as individual genes. Mammals have a tandem array with fast MyHC isoform genes termed embryonic, IIa, IId, IIb, perinatal and extraocular (Shrager et al., 2000; Weiss et al., 1999). Mammals also have the cardiac MyHCαand MyHCβgene pair (Myh6and Myh7– Mouse Genome Informatics) with MyHCβproviding the slow MyHC isoform for skeletal as well as cardiac muscle (Lompre et al., 1984; Mahdavi et al., 1984). MyHC genes elsewhere in the mammalian genome provide fast isoforms for particular craniofacial muscles (Korfage et al., 2005a). During development and regeneration, mammalian muscle fibres express different MyHC genes in a specific temporal sequence (Agbulut et al., 2003). Once fibres are formed, neural activity can remodel fibre type to suit the induced contraction behaviour (Buller et al., 1960; Buller et al., 1969).
In contrast to the single MyHCβgene in the mammalian genome, the chick has a tandem array of three slow MyHC genes with differing developmental expression patterns (Chen et al., 1997; Page
et al., 1992; Sacks et al., 2003). Analysis of chick MyHC isoforms demonstrated that embryonic muscle fibres are initially patterned as slow or fast twitch independently of neural activity (Crow and Stockdale, 1986).
In teleost fish, such as carp and medaka, different MyHC genes are expressed during different developmental stages and at different water temperatures (Liang et al., 2007; Nihei et al., 2006; Ono et al., 2006). The previously described zebrafish smyhc1gene (Bryson-Richardson et al., 2005; Nakano et al., 2004; Rauch et al., 2003) is within a tandem array of five MyHC genes that has been extensively studied on a genomic sequence basis as a classic example of gene conversion events (McGuigan et al., 2004).
In the zebrafish embryo, the first muscle fibres to form are of the slow twitch type (Devoto et al., 1996; van Raamsdonk et al., 1978). These fibres derive from precursors known as adaxial cells, so called because they lie adjacent to the axial midline structures that secrete Hedgehog (Hh) family proteins (Devoto et al., 1996). Adaxial cells respond to Hh signalling by expressing the Prdm1 transcription factor, the activity of which is both necessary and sufficient for adaxial cells to adopt the slow twitch fibre identity (Baxendale et al., 2004) and express slow MyHC (Bryson-Richardson et al., 2005; Devoto et al., 1996), and the homeodomain protein Prox1 (Glasgow and Tomarev, 1998; Roy et al., 2001). Once specified, the cells undergo a radial migration from their original medial location to form a superficial monolayer of slow twitch muscle fibres covering the embryonic myotome and subsequently a lateral wedge-shaped strip of slow muscle called the lateralis superficialis in juveniles (Devoto et al., 1996).
Following the initial wave of primary fibre differentiation in the zebrafish, further slow twitch fibres differentiate in a variety of locations. The specification of some of these secondary slow twitch fibres has been shown to be independent of Hh signalling (Barresi et al., 2001). Here, we have investigated the molecular identity of these secondary slow fibres and explored the role of Prdm1 in their specification. We show that Prdm1 activity is
Expression of multiple slow myosin heavy chain genes
reveals a diversity of zebrafish slow twitch muscle fibres with
differing requirements for Hedgehog and Prdm1 activity
Stone Elworthy, Murray Hargrave, Robert Knight, Katharina Mebus and Philip W. Ingham*
The zebrafish embryo develops a series of anatomically distinct slow twitch muscle fibres that characteristically express genes encoding lineage-specific isoforms of sarcomeric proteins such as MyHC and troponin. We show here that different subsets of these slow fibres express distinct members of a tandem array of slow MyHC genes. The first slow twitch muscle fibres to differentiate, which are specified by the activity of the transcription factor Prdm1 (also called Ubo or Blimp1) in response to Hedgehog (Hh) signalling, express the smyhc1 gene. Subsequently, secondary slow twitch fibres differentiate in most cases independently of Hh activity. We find that although some of these later-forming fibres also express smyhc1, others express smyhc2or smyhc3. We show that the smyhc1-positive fibres express the ubo (prdm1) gene and adopt fast twitch fibre characteristics in the absence of Prdm1 activity, whereas those that do not express smyhc1can differentiate independently of Prdm1 function. Conversely, some smyhc2 -expressing fibres, although independent of Prdm1 function, require Hh activity to form. The adult trunk slow fibres express smyhc2 and smyhc3, but lack smyhc1 expression. The different slow fibres in the craniofacial muscles variously express smyhc1, smyhc2and smyhc3, and all differentiate independently of Prdm1.
KEY WORDS: Zebrafish, Myotome, Fibre type, Slow myosin heavy chain, Troponin, Prox1, Shh, Blimp1,u-boot, prdm1, Craniofacial Development 135, 2115-2126 (2008) doi:10.1242/dev.015719
MRC Centre for Developmental and Biomedical Genetics and Department of Biomedical Science, University of Sheffield, Western Bank, Sheffield S10 2TN, UK.
*Author for correspondence (e-mail: [email protected])
Accepted 15 April 2008
D
E
V
E
LO
P
M
E
N
required only by a specific subset of these slow fibres that are distinguished from other secondary slow fibres by their expression of the smyhc1gene.
MATERIALS AND METHODS
Zebrafish, mutants, genotyping and cyclopamine treatment
Zebrafish embryos were kept and staged following standard methods (Kimmel et al., 1995; Westerfield, 1995). Pigmentation was inhibited by immersion in 0.2 mM N-phenylthiourea. Zebrafish mutants ubotp39, nrdm805,
smob641and smohi1640, and the transgenic line Tg(acta1:GFP)zf13have been
described previously (Barresi et al., 2000; Baxendale et al., 2004; Chen et al., 2001; Higashijima et al., 1997; Hernandez-Lagunas et al., 2005; Roy et al., 2001; van Eeden et al., 1996; Varga et al., 2001). All experiments using
Tg(PACprdm1:gfp)i106were with smob641. For other experiments, either
smob641or smohi1640were used. Genotyping for ubotp39used PCR with
primers tagtggggaacgacccttta+ggcctatttccaagtgtagtgc followed by digestion with AciI, which cuts at the site of the ubotp39point mutation but not the
wild-type allele. Cyclopamine treatment followed a standard method with immersion in 50 μM cyclopamine (Toronto Research Chemicals) from the four-cell stage or 20-somite stage (Hirsinger et al., 2004; Wolff et al., 2003).
Smyhc cDNA
RT-PCR from 14-somite stage embryos using CODEHOP (Rose et al., 1998) primer pairs gaatccgaatctgccgaaarggnttycc+cacgcccatgaaggctckdatrttcca and gaagatggagggagacctgaaygaratgga+ctgctccttcttcagctcctcngccatcat followed by 5⬘and 3⬘Smart RACE (Clontech) gave products used to design the primer pair cggggacacaggacaactcgaggtaag+gctagattagaaccagtactt -gaacatggc used to amplify an RT-PCR product spanning the smyhc1
(Accession Number EF030714)-coding sequence cloned as psmyhc1-CDS. This is the same gene as described by Bryson-Richardson et al. (Bryson-Richardson et al., 2005) and Rauch et al. (Rauch et al., 2003). smyhc2
(Accession Number BK006466) is represented by the existing cDNA IMAGE_7433531, smyhc3 (Accession Number BK006465) is represented by cDNA IMAGE_7041248. 5⬘Smart RACE from 120 hpf embryos with primer tggcgggttctgagggtgacagt gave EU526313 (Accession Number) with
the smyhc2 5⬘UTR, whereas primer gctcccggtccgacttcctgaga gave
EU218877 (Accession Number) with the smyhc35⬘UTR.
In situ hybridisation and immunofluorescence
Whole-mount in situ hybridisation (Thisse and Thisse, 1998) and cryosection in situ hybridisation (Braissant and Wahli, 1998) were as previously described. Probes were from plasmids pBlimp1 (Baxendale
et al., 2004) for prdm1, pslowtroponinC-ISH subcloned from
IMAGE_6899234 for slowtroponinC zgc:86932 (Thisse et al., 2001; Xu et al., 2006), psmyhc1-CDS with bp 1-6128 of EF030714, psmyhc1(1 to 249 bp) with bp 1-249 of EF030714, psmyhc2(1 to 324 bp) with bp 1-324 of EU526313, psmyhc2(1 to 155 bp) with bp 1-155 of EU526313 and psmyhc3
(1 to 129 bp) with bp 1-129 of EU218877. psmyhc1-CDS detects the
smyhc1,smyhc2 and smyhc3 transcripts. psmyhc2(1 to 324 bp) provides
more sensitive detection of smyhc2than does psmyhc2(1 to 155 bp) but requires high stringency conditions to avoid cross-hybridisation to smyhc1.
Chromogenic in situ hybridisation microscopy used a Zeiss Axioplan with Spot4 digital camera.
Immunofluorescence followed Devoto et al. (Devoto et al., 1996), Serbedzija et al. (Serbedzija et al., 1998) Hamade et al. (Hamade et al., 2006) and Hernandez et al. (Hernandez et al., 2005) using: mouse monoclonals F310 anti-fast myosin light chain (1:50, DSHB), MF20 anti-light meromyosin (1:500, DSHB), S58 anti-slow MyHC (1:10, DSHB), II-II6B3 anti-collagen 2a (1:500 DSHB), 15B8 anti-β-catenin (1:500 Sigma) and Bu20a anti-bromodeoxyuridine (1:100, DakoCytomation); and rabbit polyclonals anti-GFP (1:1000, Torrey Pines Biolabs) and anti-Prox1 (1:5000). Anti-Prox1 was raised against recombinant zebrafish Prox1 purified from E. coli(A. M. Taylor, personal communication). TOTO-3 iodide (Molecular Probes) was used at 200 nM. Imaging used Leica TCS SP, Olympus Fluoview FV1000 or Zeiss LSM 510 confocal microscopes with ImageJ software (Abramoff, 2004).
Fluorescent in situ hybridisation used anti-digAP and Fast Red (Roche) or anti-digPOD (at 1:10,000) and TSA Cyanine3 (Perkin Elmer).
smyhc1:gfptransgenesis
A GFP-SV40pA-FRT-Kn-FRT recombineering targeting cassette and red recombineering system in EL250 cells were used to insert EGFP with an SV40 polyadenylation site at the smyhc1ATG start site in BAC ZC227E6 (Lee et al., 2001), which has at least 80 kb of upstream sequence and an insert size of 170 kb, as determined by CHEF electrophoresis and Southern blotting. This modified BAC, linearised with PI-SceI, was used to generate stable transgenic lineTg(BAC smyhc1:gfp)i108(Higashijima et al., 1997).
Reporter plasmid p9.7kbsmyhc1:gfp-I-SceI was constructed with I-SceI sites flanking 9.7kb of smyhc1upstream sequence joined at the smyhc1ATG start site to EGFP with an SV40 polyadenylation site. p9.7kbsmyhc1:gfp-I-SceI was used to generate five stable Tg(9.7kb smyhc1:gfp) transgenic lines. Lines Tg(9.7kb smyhc1:gfp)i101, i102, i103and i104have the same expression
pattern as Tg(BAC smyhc1:gfp)i108. Line Tg(9.7kb smyhc1:gfp)i105differs in
having additional ectopic expression in the brain. For this work, we used the two lines that gave the strongest signal: Tg(BAC smyhc1:gfp)i108and
Tg(9.7kb smyhc1:gfp)i104.
prdm1:gfptransgenesis
A GFP-SV40pA-FRT-CmR-FRT recombineering targeting cassette was used to insert EGFP with an SV40 polyadenylation site at the prdm1ATG start site in PAC F2219 (Amemiya and Zon, 1999; Baxendale et al., 2004). The modified PAC, linearised with NotI, was used to generate stable transgenic lines Tg(PACprdm1:gfp)i106 and Tg(PACprdm1:gfp)i107
(Higashijima et al., 1997). A further red recombineering step removed all sequences downstream of the SV40 polyadenylation site. This PAC, linearised with Not1, was used to generate stable transgenic line
Tg(–60prdm1:gfp)i111. Tg(PACprdm1:gfp)i106was used in smomutants.
Tg(PACprdm1:gfp)i106and Tg(PACprdm1:gfp)i107partially rescue the ubotp39
phenotype and so Tg(–60prdm1:gfp)i111was used in ubo (prdm1)mutants.
Tg(–60prdm1:gfp)i111 gives the same expression pattern as
Tg(PACprdm1:gfp)i106and Tg(PACprdm1:gfp)i107when transmitted from
males, but gives ubiquitous maternal expression. Tg(–60prdm1:gfp)i111
males were crossed to non-transgenic females to provide the embryos used for this study.
BrdU analysis
BrdU pulse labelling followed Park and Appel (Park and Appel, 2003). Fixed, BrdU-labelled embryos were exposed to 1.7 N HCl for 60 minutes prior to a 90 minute 10 μgml-1 proteinase K digestion and standard
immunofluorescence. Specimens were examined over a three-somite wide view at the level of the anus. The full thickness of the myotome was scanned at 0.57 μm intervals by confocal microscopy and all the individual images in the confocal stack were inspected to count BrdU labelled nuclei.
RESULTS
The expression of different slow MyHC genes defines distinct groups of slow twitch muscles The slow MyHC specific antibodies F59 and S58 (raised against chicken myosin) have been widely used as markers for investigations of muscle fibre type specification in zebrafish embryos (Devoto et al., 1996; Hernandez et al., 2005). Expression of a slow MyHC gene, designated smyhc1, has previously been reported in F59-positive muscle fibres in early embryos, suggesting that it may encode the epitope recognised by F59 and S58 in zebrafish (Bryson-Richardson et al., 2005; Nakano et al., 2004; Rauch et al., 2003). Using in situ hybridisation, we confirmed that a probe complementary to the coding sequence of this gene (smyhc1-CDS) detects slow fibres in a diverse set of muscles (Fig. 1A) (Rauch et al., 2003). To investigate the expression of this gene further, we generated gfp reporter constructs; surprisingly, we found that transgenic animals carrying these constructs expressed GFP in only a subset of the S58-positive muscles (Fig. 1A). This could imply that the smyhc1 expression pattern is not fully recapitulated by our reporter genes; alternatively, it may be that the smyhc1-CDS probe detects
D
E
transcripts from more than one Smyhc gene. Consistent with this latter hypothesis, genomic analysis has shown that zebrafish smyhc1 resides within a tandem array of five genes that have a remarkable level of DNA sequence identity (Fig. 1C) (McGuigan et al., 2004). The long stretches of DNA sequence identity between smyhc1and the other genes in the tandem array, including a 270 bp stretch of 100% nucleotide identity between smyhc1and the adjacent gene in the tandem array cause the CDS probe to cross hybridise, confounding expression analysis of the individual genes. We therefore synthesised gene-specific 5⬘UTR probes to resolve the expression of these genes in different slow fibres by in situ hybridisation (Fig. 1; see Fig. S1 and Table S1 in the supplementary material; Fig. 3).
The smyhc1- (1 to 249 bp) 5⬘UTR probe confirmed that the smyhc1:gfp reporter genes precisely recapitulate the expression pattern of the endogenous gene. The adaxial cells express smyhc1, as do the primary surface slow fibres and muscle pioneers to which they give rise (Fig. 1D; see Fig. S1 in the supplementary material).
From 48 hpf, a series of muscles differentiate with slow twitch fibres that express smyhc2but not smyhc1 (Fig. 1D-G, see Fig. S1 and Table S1 in the supplementary material). The third gene in the tandem array, which we call smyhc3, has very short UTR sequences, making detection by in situ hybridisation difficult. Nevertheless, we could observe at the limit of detection smyhc3expression in some of the smyhc2-positive trunk muscles (Fig. 1H; see Table S1 in the supplementary material).
In contrast to the differential expression of the Smyhc genes,slow troponin C is expressed in all slow MyHC-expressing fibres throughout the embryo (see Fig. S2 in the supplementary material) (Thisse et al., 2001). Expression is restricted to S58-positive fibres except in the pectoral fin muscle that is S58 negative but strongly expresses slow troponin C (see Fig. S2 in the supplementary material); the physiological status of this muscle is unclear.
[image:3.612.55.504.61.337.2]There is expression of smyhc2at 72 hpf andsmyhc3at 96 hpf in a few fibres lateral to the horizontal myoseptum that we have called the embryonic lateralis superficialis (Fig. 1D,F,H; see Fig. S1 in the supplementary material). These few fibres may later become Fig. 1. Different Smyhc genes have distinct expression patterns.(A) At 96 hpf, the smyhc1:gfpreporter gene is expressed in a subset of the slow fibres labelled with the S58 anti slow MyHC Ab or the smyhc1-CDS in situ hybridisation (ISH) probe. The iob is a major muscle that does not express smyhc1:gfpin its slow fibres. (B) High magnification lateral view of smyhc1-CDS in situ hybridisation in posterior trunk showing transcript is concentrated at the ends of the superficial slow fibres. (C) A diagram illustrating the tandem array of Smyhc genes as described by McGuigan et al. (McGuigan et al., 2004) together with the gene names used here. We followed the Bryson-Richardson et al. (Bryson-Richardson et al., 2005) renaming of myhcEas smyhc1 and similarly renamed the adjacent genes smyhc2 and smyhc3.(D) Differential expression of Smyhc genes at 96 hpf, as shown by in situ hybridisation using smyhc1 (1 to 249 bp) or smyhc2(1 to 324 bp) probes. The sca, els, iob, sh, scp and icp somite-derived muscles, and dorsal and ventral craniofacial muscles express smyhc2. (E)smyhc1:gfptogether with smyhc2(1 to 324 bp) in situ hybridisation at 96 hpf. (F) At 96 hpf, smyhc2 (1 to 324 bp) in situ hybridisation shows colocalisation with slow MyHC S58 antigen but not with smyhc1:gfp in the sca muscle (dorsal view anterior trunk), els or iob muscles (lateral view anterior trunk) or scp or icp muscles (lateral view posterior tail). (G) A deep focus ventral view shows smyhc2(1 to 324 bp) expression in the oesophagus at 96 hpf. (H) The low sensitivity smyhc3(1 to 129 bp) in situ hybridisation weakly detects expression in the sca and els muscles at 96 hpf, as shown by dorsal and lateral views of the anterior trunk. Scale bars: 25 μm. Abbreviations: dm, head dorsal muscles; els, embryonic lateralis superficialis; icp, infracarinalis posterior; iob, inferior obliquus; oes, oesophagus; sca, supracarinalis anterior; scp, supracarinalis posterior; sh, sternohyoideus; vm, head ventral muscles. Muscle nomenclature is taken from previous work (Schilling and Kimmel, 1997; Stiassny, 2000; Winterbottom, 1974).
D
E
V
E
LO
P
M
E
N
incorporated into the lateralis superficialis muscle that forms at this location in juveniles predominantly from adaxially derived fibres (Devoto et al., 1996). At 32 dpf, smyhc1 and smyhc2 are co-expressed in the lateralis superficialis (Fig. 2A). By 42 days post fertilisation (dpf), the trunk lacks smyhc1 expression (data not shown), and smyhc2 and smyhc3 are expressed in the lateralis superficialis muscles (Fig. 2C). GFP is known to persist long after reporter transcription has ceased (Tallafuss and Bally-Cuif, 2003). This presumably explains why lateral fibres of the 42 dpf lateralis superficialis are still marked with smyhc1:gfp(Fig. 2B). The adult lateralis superficialis lacks smyhc1 expression (data not shown) and has a complex complementary expression of smyhc2andsmyhc3 (Fig. 2D).
From 48 hpf, a series of craniofacial muscles develop from cranial paraxial mesoderm (Schilling and Kimmel, 1997). Most of these muscles comprise both slow fibres and fast fibres (Hernandez et al., 2005). As in the trunk and tail, slow troponin C is expressed in all S58-positive craniofacial muscles (Fig. 3A,B,E). Most of these slow fibres express both smyhc1and smyhc2(Fig. 3A-D; see Table S1 in the supplementary material). Strikingly, however, smyhc1
expression is absent from the slow fibres of a disparate subset of the craniofacial muscles (Fig. 3; see Table S1 in the supplementary material; Fig. 1D). Furthermore, some muscles contain both clusters of fibres that co-express smyhc1 with smyhc2, and also clusters that just express smyhc2(Fig. 3D).
Despite the limitations of the smyhc3 probe, intense smyhc3 expression was detected in the levator arcus palatini muscle that lacks smyhc1expression (Fig. 3A). Weaker smyhc3 expression was detected in certain other craniofacial muscles (Fig. 3A,B).
Using S58 staining, Barresi et al. (Barresi et al., 2001) showed that slow fibres are added all along the dorsal and ventral margins of the primary superficial slow fibre layer after 24 hpf. As most of this region is devoid ofsmyhc2and smyhc3(Fig. 1D; see Fig. S1 in the supplementary material) it seems probable that these secondary fibres express smyhc1.To distinguish such fibres from their primary counterparts, we adopted the BrdU labelling technique used by Barresi et al. (Barresi et al., 2001). Exposure of smyhc1:gfp embryos to BrdU at 18 hpf, resulted in extensive labelling of fast muscle and external cell nuclei across all dorsal ventral levels of the myotome at 48 hpf, in accordance with the recent report of Stellabotte et al. (Stellabotte et al., 2007) (Fig. 4A,B). By contrast, only smyhc1:gfp-positive slow fibres at the dorsal and ventral margins of the layer of superficial slow fibres were BrdU labelled (Fig. 4B-D; see Movie 1 in the supplementary material). Exposure to BrdU at 35 hpf similarly led by 96 hpf to BrdU-labelled, smyhc1:gfppositive, fibres only at the dorsal and ventral margins (Fig. 4C,D). These findings establish that these fibres do indeed express smyhc1. We refer to these fibres as ‘secondary superficial slow fibres’ to distinguish them from the series of smyhc2-expressing secondary slow fibres.
smyhc1and smyhc2expressing secondary fibres differ in their requirement for Hedgehog
signalling
[image:4.612.53.299.62.311.2]Previous studies have shown that some secondary slow fibres can differentiate normally in the absence of Hh signalling activity, in contrast to their primary counterparts (Barresi et al., 2001). We investigated the identity of these Hh-independent fibres using the gene-specific Smyhc probes. Embryos either mutant for the Hh signal transducer Smoothened (smo) or treated with the Smo antagonist cyclopamine, have extensive secondary superficial slow fibres at the dorsal and ventral margins of the posterior trunk and the tail that express smyhc1 and not smyhc2 (Fig. 5A,C,D). Expression of smyhc2in smomutants is similar to that in wild type; however, the embryonic lateralis superficialis fibres are absent, as are the smyhc2-expressing fibres of the tail (Fig. 5D; see Table S1 in the supplementary material). This lack of the smyhc2-expressing fibres of the tail is strikingly similar to the loss of third wave slow muscle reported for cyclopamine-treated Xenopus embryos (Grimaldi et al., 2004). We treated embryos with cyclopamine from the 20-somite stage to determine whether zebrafish have a similar requirement for Hh signalling during slow fibre myogenesis late in embryogenesis. These treated embryos had a normal pattern of smyhc1:gfp and smyhc2expression except for the lack of the tail smyhc2-expressing slow fibres (Fig. 5E). The posterior tails of these embryos had a narrower dorsal-ventral extent and lacked any muscle dorsal or ventral of the smyhc1-expressing layer (Fig. 5F), suggesting that Hh signalling is required for the formation of this muscle. This contrasts with its role in specifying the fibre type of adaxial cells but is strikingly similar to the generation of third wave slow muscle in Xenopus (Grimaldi et al., 2004).
Fig. 2. Expression of smyhc1, smyhc2and smyhc3 in the juvenile and adult trunk.All panels show trunk transverse cryosections. (A) At 32 dpf smyhc1 (1 to 249 bp) in situ hybridisation shows expression in the lateralis superficialis, while smyhc2 (1 to 324 bp) in situ
hybridisation shows colocalisation withsmyhc1:gfpin the lateralis superficialis. (B) At 42 dpf, smyhc1:gfpshows colocalisation with slow MyHC S58 antigen in the lateralis superficialis, which is not fast muscle F310 antigen positive. (C) At 42 dpf, smyhc2 (1 to 324 bp) and smyhc3 (1 to 129 bp) in situ hybridisation shows expression in the lateralis superficialis. smyhc1 (1 to 249 bp) in situ hybridisation on adjacent sections failed to detect any expression. (D) Adjacent sections of 22 month post-fertilisation adult with smyhc2(1 to 324 bp) and smyhc3 (1 to 129 bp) in situ hybridisation showing expression in subsets of the slow MyHC S58 antigen positive, fast muscle F310 antigen negative, lateralis superficialis.smyhc1 (1 to 249 bp) in situ hybridisation on adjacent sections failed to detect any expression throughout the trunk. Scale bars: 25 μm.
D
E
V
E
LO
P
M
E
N
Hedgehog independent smyhc1 expressing
secondary superficial slow fibres require prdm1
Using the highly sensitivesmyhc1-CDS in situ hybridisation probe, we have compared the ontogeny of slow twitch muscle fibres in prdm1 mutant, smomutant and wild-type embryos (Fig. 6A; we use ‘Smyhc’ to mean transcripts detected with the smyhc1-CDS probe). Consistent with the report of Barresi et al. (Barresi et al., 2001), we found that in smomutant embryos, slow fibres are virtually absent at 24 hpf, but subsequently appear at the dorsal and ventral margins of the somites at 36 hpf, increasing in number by 48 hpf. By contrast, in prdm1mutants at 24 hpf, we found that many fibres scattered through the myotome show low levels of Smyhc expression, in line with previous descriptions of the ubo(prdm1)tp39mutant phenotype (Roy et al., 2001). This Smyhc expression was observed not only in
[image:5.612.55.491.236.586.2]embryos homozygous for the ubo(prdm1)tp39mis-sense allele but also in those homozygous for nrd(prdm1)m805, which has a stop codon at amino acid 154 and is thus a presumptive null allele (Hernandez-Lagunas et al., 2005) (Fig. 6A). Notably, a few fibres have a less dramatic reduction in expression and these tend to be more dorsal and more numerous in posterior somites. By 48 hpf, the scattered expression of Smyhc throughout the myotome is greatly diminished, but expression persists in fibres at the dorsal margin. The location of these latter fibres is similar to that of the secondary superficial slow fibres, raising the possibility that at least some secondary superficial slow fibres can form in the absence of prdm1 function. Alternatively, these could correspond to adaxially derived, primary slow fibres that escape the requirement for wild-type levels of prdm1function.
Fig. 3. Differential expression of Smyhc genes in craniofacial muscles.(A) Lateral and ventral views of the dorsal group of craniofacial muscles at 96 hpf with slow troponin C (stnnC), smyhc1 (1 to 249 bp), smyhc2(1 to 324 bp) or smyhc3 (1 to 129 bp) in situ hybridisation (see Fig. 1A,D,E,G for gross location of these muscles). The lap and do lack smyhc1expression while smyhc3expression is restricted to the lap. (B) Ventral views showing ventral craniofacial muscles at 96 hpf with slow troponin C (stnnC), smyhc1 (1 to 249 bp), smyhc2 (1 to 324 bp) or smyhc3 (1 to 129 bp) in situ hybridisation. The ima, sh, iob and posterior tv lack smyhc1expression. (C) Lateral and ventral views of the dorsal group of craniofacial muscles at 96 hpf showing colocalisation of slow MyHC S58 antigen with smyhc2(1 to 324 bp) in situ hybridisation and, in the ao and lo, with smyhc1:gfp. (D) Ventral view at 96 hpf showing colocalisation of smyhc1:gfpand smyhc2(1 to 324 bp) in situ
hybridisation with slow MyHC S58 antigen. In the am, some fibres express smyhc2and S58 antigen but not smyhc1:gfp(blue arrows). Some fibres express S58 antigen but neither smyhc2nor smyhc1:gfp (white arrows).The extraocular muscles have zones of S58 antigen-expressing fibres that co-express smyhc1:gfpand zones that do not (pink arrows). (E) Ventral view at 96 hpf showing expression of slow troponin C in situ hybridisation (stnnC) in all slow MyHC S58 antigen-expressing fibres. Scale bars: 25 μm. Abbreviations: abh, abductor hyoideus; am, adductor mandibulae; ao, adductor operculi; do, dilator operculi; hh, hyohyoidus; ih, interhyoideus; ima, intermandibularis anterior; imp,
intermandibularis posterior; io, inferior oblique; iob, inferior obliquus; ir, inferior rectus, lap, levator arcus palatini; lo, levatator operculi; sh,
sternohyoideus; tv, transversus ventralis.
D
E
V
E
LO
P
M
E
N
To distinguish between these possibilities, we eliminated primary slow muscle fibres from ubo(prdm1)tp39mutant embryos by treating them with the Smo antagonist cyclopamine (Hirsinger et al., 2004; Wolff et al., 2003). Such embryos are essentially devoid of both primary and secondary superficial slow fibres at 48 hpf, as indicated by the absence in the tail and posterior trunk of both Smyhc and slow troponin C expression (Fig. 6B). It follows from this finding that the persistent dorsal slow fibres seen in ubo(prdm1)tp39mutants are adaxially derived primary slow fibres and that prdm1function is essential for the differentiation of the secondary superficial slow fibres that form normally in the absence of Hh signalling.
By contrast, the smyhc2-expressing fibres are largely unaffected by the loss of prdm1 activity, though the embryonic lateralis superficialis muscles are lost in nrd(prdm1)m805mutants as in smo mutants (Fig. 6C; see Table S1 in the supplementary material). This may be a secondary consequence of the aberrant somite morphology caused by lack of the horizontal myoseptum.
The craniofacial muscles generally have wild-type levels of expression of both smyhc1 and smyhc2 in nrd(prdm1)m805 mutants (see Fig. S3B and Table S1 in the supplementary material; Fig. 6C). The only perturbations to the craniofacial slow fibres in prdm1mutants are associated with the major loss of skeletal elements in the posterior head (see Fig. S3A in the supplementary material) (see also Wilm and Solnica-Krezel, 2005).
prdm1:gfpexpression in primary and secondary slow fibres
We next investigated whether prdm1is expressed in the precursors of the secondary superficial (smyhc1+ve) slow fibres. Low-level prdm1expression can be detected by in situ hybridisation at 35 hpf in cells tentatively identified as newly forming secondary superficial slow fibres in smomutants (Fig. 7A). To characterise this expression further, we took advantage of the stability of GFP transcript and protein (Tallafuss and Bally-Cuif, 2003) to monitor prdm1expression using prdm1:gfpreporter lines. The expression of GFP in these lines (Fig. 7B) recapitulates the pattern of endogenous prdm1transcription in adaxial cells (Baxendale et al., 2004) but persists as the cells migrate and differentiate into the superficial layer of mononucleated slow fibres that covers the mytotome at 24 hpf (Fig, 7C). As expected, in smomutants carrying the prdm1:gfptransgene, no such labelled fibres are present at 24 hpf (Fig. 7C). At 48 hpf, however, prdm1:gfp-positive fibres are present at the dorsal and ventral margins of the myotome, locations consistent with their being secondary superficial slow fibres. Simultaneous staining for Smyhc or slow troponin C expression confirmed that the prdm1:gfp-positive fibres are indeed secondary superficial slow fibres (Fig. 7D). In addition, we also found that these fibres accumulate Prox1 in their nuclei (although at lower levels than their primary counterparts) (Fig. 7E) and lack expression of the fast muscle F310 antigen (Fig. 7F). Intriguingly, prdm1:gfpis specifically expressed not only in the smyhc1expressing slow fibres but also in the slow fibres of muscles that express smyhc2and not smyhc1 (Fig. 7G, see also Fig. 1D,F).
Transformation of secondary superficial slow fibres to a fast twitch character in ubo (prdm1)
mutants
We next analysed the fate of primary and secondary superficial slow fibre precursors in ubo(prdm1)tp39mutants using the prdm1:gfp transgene as a lineage marker. At 24 hpf, prdm1:gfpcolocalises with the scattered weakly Smyhc-positive cells typical of ubo(prdm1)tp39
mutants, indicating that these are derived from adaxial cells that have failed to migrate properly owing to the loss of prdm1function (Fig. 8A). Although by 48 hpf Smyhc expression is lost from all but the most dorsal fibres, the scattered prdm1:gfppositive cells persist (Fig. 8A) and differentiate into fibres that are multinucleate and F310 positive, characteristics that are typical of fast twitch fibres (Hamade et al., 2006; Roy et al., 2001) (Fig. 8B,C). Similarly, even the dorsal fibres in which slow MyHC expression persists are marked by both prdm1:gfpand the fast muscle F310 antigen (Fig. 8D) and lack expression of Prox1 (Glasgow and Tomarev, 1998) (Fig. 8E).
[image:6.612.317.559.268.495.2]At 48 hpf, cylopamine-treated transgenic ubo(prdm1)tp39mutant embryos have the normal complement of prdm1:gfp-positive fibres at the location of the secondary superficial slow fibres in their genetically wild-type siblings. However, unlike those in the latter, these fibres do not express slow MyHC and do express the fast fibre-specific F310 antigen (Fig. 8F).
Fig. 4. BrdU labelling shows that wild type embryos have smyhc1-expressing secondary superficial slow fibres. All panels show lateral views of posterior trunk, level with the anus. (A) At 48 hpf, embryos exposed to BrdU at 18 hpf show extensive BrdU co-labelling with acta1:gfpin nuclei that have the characteristic fast muscle elongated and diagonal morphology. (B) At 48 hpf, embryos exposed to BrdU at 18 hpf have BrdU-labelled nuclei superficial to the
smyhc1:gfp-labelled surface slow fibres in the presumptive external cell layer (nuclei superficial to the surface slow fibres; these nuclei have a characteristic large flattened disk morphology) and immediately medial to the surface slow fibres, but not in the main body of the surface slow fibre layer (see also Movie 1). (C) BrdU and smyhc1:gfp co-labelling at dorsal somite margin at 48 hpf after BrdU exposure at 18 hpf, and at ventral somite margin 96 hpf after BrdU exposure at 35 hpf. (D) Scatter plots showing number of BrdU and smyhc1:gfp co-labelled nuclei in the dorsal or ventral myotome within a three-somite view at the level of the anus. Each dot represents the count in one embryo. The lines show the mean. Data are shown for exposure to BrdU at 18 hpf or 35 hpf, and with analysis at 48 hpf or 96 hpf. The BrdU labelled smyhc:gfpnuclei were always the smyhc1:gfpnuclei closest to the dorsal or ventral margin of the myotome. (E) At 48 hpf, embryos exposed to BrdU at 35 hpf have extensive labelling in cell types other than the surface slow
fibres. Scale bars: 25 μm.
D
E
V
E
LO
P
M
E
N
DISCUSSION
The zebrafish embryo develops a series of distinct muscle types with slow twitch fibres. We show here that these different slow fibres can be distinguished by the expression of the smyhc1, smyhc2 and smyhc3 genes that form a tandem array in the genome. During the juvenile period, there is an apparent transition from smyhc1to smyhc2and smyhc3expression in the lateralis superficialis. This is reminiscent of the developmental transitions in MyHC isoform expression in amniotes. The chick also has three tandemly arrayed slow MyHC genes that are expressed with differing developmental control, timing and subcellular transcript localisation (Sacks et al., 2003). We do not know whether this arrangement of slow MyHC genes is evolutionarily ancient or arose independently in each lineage. A molecular phylogenic assessment of this issue is hampered by gene conversion events within the zebrafish Smyhc tandem array (McGuigan et al., 2004).
[image:7.612.52.510.59.359.2]The expression of slow troponin Cindicates that pan slow lineage expression can be driven by elements associated with a single transcription unit. This raises the issue as to what evolutionary constraints have produced the Smyhc tandem array genomic structure. McGuigan et al. have previously described the extraordinary level of DNA sequence conservation between the genes in the Smyhc tandem array (McGuigan et al., 2004). Although frequent and recent gene conversion events have acted to maintain this sequence conservation, it is conceivable that the remaining amino acid differences between the different gene products may have functional significance. The regions of most amino acid sequence divergence correspond to the 25-50 junction and 25-50-20 junction. These regions show low sequence conservation across the myosin classes (Cope et al., 1996), although there is evidence that their sequence can influence the enzymatic activity of myosins (reviewed by Murphy and Spudich, 2000). Establishing whether these differences confer functional changes will require biochemical and physiological analyses.
Fig. 5. Hedgehog dependent and independent smyhc1and smyhc2expression.All panels show lateral views. (A) smyhc1 (1 to 249 bp) in situ hybridisation at 48 hpf showing expression in secondary superficial slow fibres at the dorsal and ventral edges of the somites of a smo mutant. (B) smyhc2 (1 to 155 bp) in situ hybridisation at 48 hpf showing wild-type levels of expression in the iob of smomutant (see Fig. S1 in the supplementary material for comparison with wild type). (C) Untreated and cyclopamine treated 55 hpf embryos showing Hh-independent smyhc1:gfpin the secondary superficial slow fibres and Hh-independent smyhc2(1 to 324 bp) in situ hybridisation signal in the sca and iob. (D) 96 hpf wild-type sib and smo mutant. The smomutant has slow MyHC S58 antigen in iob, sca and secondary superficial slow fibres; smyhc2 (1 to 324 bp) in situ hybridisation signal in iob and sca; but lacks scp and icp smyhc2(1 to 324 bp) in situ hybridisation signal.(E) Untreated embryo and embryo exposed to cyclopamine from the 20-somite stage. This late cyclopamine exposure does not eliminate the smyhc1:gfp surface slow fibres but does eliminate smyhc2(1 to 324 bp) in situ hybridisation signal in the scp and icp, as well as causing a dorsoventral narrowing of the posterior tail. Fifteen out of 15 embryos with this treatment showed this phenotype. (F) High-magnification views of posterior tail in untreated embryo and embryo exposed to cyclopamine from the 20-somite stage. In untreated embryos, smyhc2(1 to 324 bp) in situ hybridisation signal colocalises with the general muscle MF20 antigen in the scp and icp dorsal and ventral to the smyhc:gfpsurface slow fibre layer. The treated embryos lack scp and icp smyhc2(1 to 324 bp) in situ hybridisation signal and general muscle MF20 antigen dorsal or ventral to the smyhc:gfpsurface slow fibre layer. Scale bars: 25 μm. Abbreviations: icp, infracarinalis posterior; iob, inferior obliquus; sca, supracarinalis anterior; scp, supracarinalis posterior.
D
E
V
E
LO
P
M
E
N
The evolution of the tandem array genomic structure may have been driven by transcriptional control constraints. The fact that our 9.7 kb promoter smyhc1:gfp reporter gene recapitulates the expression of the endogenous gene, indicates that, for smyhc1 expression, at least, the adjoining parts of the tandem array are not required in cis for transcriptional control. The tandem arrangement of mammalian MyHC genes is constrained by bidirectional expression of MyHC genes and antisense transcripts required for transcriptional control of adjacent MyHC genes (Haddad et al., 2003; Pandorf et al., 2006). We do not know whether such a mechanism exists in zebrafish.
The mammalian craniofacial muscles express an especially diverse selection of MyHC genes. This is thought to reflect intricate functional requirements in these muscles (Korfage et al., 2005a; Korfage et al., 2005b; Noden and Francis-West, 2006). The complex expression patterns of Smyhc genes in the zebrafish embryonic craniofacial muscles may have an analogous functional significance.
There are two additional predicted genes [called myhA and myhcBby McGuigan et al. (McGuigan et al., 2004)] in the same tandem gene array as the three Smyhc genes we describe here. Although myhA and myhB are not represented in current EST databases, we isolated 5⬘RACE products for two alternative 5⬘UTRs of myhAusing RNA from 120 hpf embryos. We were unable to detect any expression in embryos by in situ hybridisation. Possibly, the predicted genes are expressed principally at later stages of the life cycle or under different growth conditions.
[image:8.612.54.489.59.385.2]Prdm1 acts as a transcriptional repressor to drive the differentiation of adaxial cells into primary slow twitch fibres in response to Hh signalling (Baxendale et al., 2004; von Hofsten et al., 2008). Our analysis shows that prdm1is also required for secondary superficial slow fibres to adopt a slow twitch character independently of Hh signalling. How expression of prdm1 is activated in the progenitors of these secondary superficial slow fibres remains to be determined.
Fig. 6. Hedgehog-independent secondary superficial slow fibres require Prdm1, whereas smyhc2expression does not. (A) Lateral views of smyhc1-CDS in situ hybridisation on 24 hpf, 36 hpf and 48 hpf smomutants, ubo (prdm1)tp39mutants, nrd (prdm1)m805and wild-type (wt)
siblings; and transverse sections of 24 hpf ubo (prdm1)tp39mutants and wild-type siblings. The near absence of Smyhc-expressing primary slow
fibres in smomutants at 24 hpf allows secondary slow fibres to be identified unambiguously at later stages. At 24 hpf, ubo (prdm1)tp39or nrd (prdm1)m805mutants have abundant, misplaced, weakly Smyhc-expressing fibres. Thus, it is unclear whether Smyhc-expressing fibres at later stages
in prdm1mutants are simply the remnants of those present at 24 hpf. (B) When primary slow fibre specification is prevented by cyclopamine treatment, 48 hpf genotyped ubo (prdm1)tp39mutants lack almost all smyhc1-CDS in situ hybridisation and slow troponin C (stnnC) in situ
hybridisation in secondary superficial slow fibres, whereas genotyped wild-type siblings have robust expression. (C) smyhc2(1 to 155 bp) in situ hybridisation showing 96 hpf nrd (prdm1)m805mutants have near wild-type levels of expression in the sca, iob, scp, icp and craniofacial muscles, but
lack smyhc2-expressing els fibres. High magnification dorsal views show sca and lateral views show iob and scp/icp. Scale bars: 25 μm.
Abbreviations: els, embryonic lateralis superficialis; icp, infracarinalis posterior; iob, inferior obliquus; sca, supracarinalis anterior; scp, supracarinalis posterior.
D
E
V
E
LO
P
M
E
N
Intriguingly, the specific expression of prdm1:gfp in slow fibres extends beyond the smyhc1-positive fibres and includes the smyhc2-positive fibres for which we could discern no prdm1 requirement. We consider it likely that this prdm1:gfp expression reflects the expression of the endogenous gene, as we have observed it in three independent prdm1:gfp reporter gene lines. It remains possible that prdm1acts redundantly with some other gene in these fibres or has a subtle role we failed to discern.
Although specification of slow fibre type shows diversity in its requirement for Hh signalling and prdm1activity, it is possible that there is a common basis for slow fibre type determination at a more downstream step. The specific expression of slow troponin C across all slow fibres could result from a shared transcriptional program specifying slow fibre type that is common to different slow muscles. Alternatively, the slow troponin C expression may be determined by a composite of independent transcriptional control elements for each of the different types of slow fibre. The complex transcriptional control of mouse Myf5 in myogenic cells provides an example of numerous independent control elements acting in distinct muscle types (Carvajal et al., 2001; Hadchouel et al., 2003).
The origin of the progenitor cells for the various secondary slow fibres and their relationship to the recently identified, Pax7-positive, secondary fast muscle progenitors is currently unclear (Hammond et al., 2007; Hollway et al., 2007; Stellabotte et al., 2007). An additional issue is the mechanism for myogenic induction versus progenitor maintenance for secondary slow fibres. Hh signalling induces the myogenesis of primary slow fibres and also of lateral fast fibres in the primary myotome (Feng et al., 2006; Hammond et al., 2007; Lewis et al., 1999). Our data suggest that Hh signalling is also required for myogenesis of the smyhc2-expressing slow fibres of the posterior tail. This shows a striking similarity to third wave slow fibre myogenesis in Xenopus, suggesting that it is an evolutionarily ancient mechanism (Grimaldi et al., 2004).
It is unknown how various slow fibres are specified to express particular Smyhc genes. This question possibly relates to the more general issue of muscle identity determination. Muscle identity may be influenced by intrinsic cues, as well as signalling from other cell types. In zebrafish, anterior trunk somites have an intrinsic axial identity that enables them to produce appendicular muscle (Haines et al., 2004). Earlier in development, paraxial mesoderm for different axial levels is specifically determined by different
Fig. 7. The prdm1:gfptransgenic reporter marks primary and secondary slow fibres.(A) Weak prdm1in situ hybridisation in presumptive secondary superficial slow fibre cells (arrows) at 35 hpf in smo mutants. (B) prdm1:gfpfluorescence in adaxial cells at the six-somite stage is almost eliminated in smomutants. (C) At 24 hpf, Prox1-expressing primary slow fibres are marked with prdm1:gfpand are absent in smomutants. (D) Lateral views of posterior trunk of 48 hpf smo mutants showing prdm1:gfpcolocalised with smyhc1-CDS in situ hybridisation and slow troponin C (stnnC) in situ hybridisation in secondary superficial slow fibres at the dorsal and ventral edges of the somites. (E) In smomutants, prdm1:gfpcolocalises with Prox1 antigen in secondary fibres (arrows) in somite 13 at 36 hpf. Note the intense Prox1 staining in isolated cells that are external to the myotome (arrowheads). (F) At 48 hpf, in smomutant posterior trunk, slow MyHC S58 antigen and prdm1:gfpmark secondary superficial slow fibres that do not colocalise with fast muscle F310 antigen. (G) Dorsolateral view of the iob and dorsal view of the sca at 96 hpf showing colocalisation of prdm1:gfpwith slow MyHC S58 antigen but not with fast muscle F310 antigen (see Fig. 1 for gross location of these muscles). Scale bars: 25
μm. Abbreviations: iob, inferior obliquus; sca, supracarinalis anterior.
D
E
V
E
LO
P
M
E
N
[image:9.612.52.398.59.465.2]combinations of Nodal, Bmp and Fgf signals (Szeto and Kimelman, 2006). Numerous Hox genes are expressed in particular regions of the paraxial mesoderm (Prince et al., 1998). Possibly, certain paraxial mesoderm cells are predisposed to form certain types of slow fibre by such intrinsic cues. Intrinsic cues may also influence whether muscle has a fast twitch or slow twitch character (Nikovits, Jr et al., 2001).
In the head in particular, the different Smyhc genes reveal an unprecedented detail of molecular diversity in the slow fibres. A single Engrailed-expressing condensation of first arch mesoderm splits to form the adjacent levator arcus palatini and dilator operculi (Hatta et al., 1990), and yet the levator arcus palatini expresses high levels of smyhc3while the dilator operculi has barely detectable levels. The differential expression of Smyhc genes between different fibres within craniofacial muscles such as the adductor mandibulae is equally remarkable.
The different Smyhc genes described here will provide valuable late differentiation markers for experimental studies required to understand the specification of muscle identity.
We thank L. Gleadall, M. Green, F. Browne and S. Surfleet for expert zebrafish husbandry; J. Sanderson for imaging advice; K. Ohymama for cryosection in situ hybridisation advice; K. Berry, C. Moore, A. Burguiere, A. Taylor and C. Davison for generating and characterising reagents; anonymous reviewers for helpful suggestions; H. Roehl, S. Baxendale and F. van Eeden for helpful discussions; N. Copeland for the EL250 strain; and K. Artinger for nrdm805 zebrafish. This research project was funded by a UK Medical Research Council (MRC) Programme Grant (G0100151) and by the EU MYORES Network of Excellence. The CDBG Zebrafish Aquaria was supported by an MRC Centre Development Grant (G0400100) to P.W.I. Imaging facilities were funded by the MRC, Wellcome Trust and Yorkshire Cancer Research.
Supplementary material
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/135/12/2115/DC1
Fig. 8. The prdm1:gfptransgenic reporter provides a lineage tracer to follow the fate of prdm1-dependent muscle precursors in ubo (prdm1) mutants.(A) Transverse sections show colocalisation prdm1:gfpwith smyhc1-CDS in situ hybridisation in ubo (prdm1)tp39mutants and
wild-type siblings at 24 hpf. At 48 hpf, the prdm1:gfpmarked muscle fibres are still present in ubo (prdm1)tp39mutants, although Smyhc expression
is reduced. Cell boundaries are marked with anti-β-catenin 15B8. (B) Lateral views showing that muscle fibres with prdm1:gfpform a superficial layer of horizontal, mononucleate fibres in 48 hpf wild-type embryos but are among the fast fibres in ubo (prdm1)tp39mutants and like fast fibres
are frequently multinucleate (TOTO stain) and orientated diagonally. (C) Transverse sections at 48 hpf show colocalisation of F310 fast muscle antigen with prdm1:gfpin ubo (prdm1)tp39mutants but not in wild-type siblings. (D) In posterior trunk at 48 hpf, in ubo (prdm1)tp39mutants, the
dorsal fibres with persistent slow MyHC S58 antigen are marked with prdm1:gfpand fast muscle F310 antigen. (E) In posterior trunk at 36 hpf, in ubo (prdm1)tp39mutants, even the most dorsally positioned fibres marked with prdm1:gfplack Prox1 (arrows). Note the intense Prox1 staining in
isolated cells external to the myotome (arrowheads). (F) In posterior trunk of cyclopamine-treated embryos, prdm1:gfpmarked secondary fibres colocalise with slow MyHC S58 antigen but not fast muscle F310 antigen in genotyped wild-type siblings and vice versa in genotyped ubo (prdm1)tp39mutants. Scale bars: 25 μm.
D
E
V
E
LO
P
M
E
N
[image:10.612.53.477.57.396.2]References
Abramoff, M. D., Magelhaes, P. J. and Ram, S. J.(2004). Image Processing with ImageJ. Biophotonics Int.11, 36-42.
Agbulut, O., Noirez, P., Beaumont, F. and Butler-Browne, G.(2003). Myosin heavy chain isoforms in postnatal muscle development of mice.Biol. Cell95, 399-406.
Amemiya, C. T. and Zon, L. I.(1999). Generation of a zebrafish P1 artificial chromosome library. Genomics58, 211-213.
Barresi, M. J., Stickney, H. L. and Devoto, S. H.(2000). The zebrafish slow-muscle-omitted gene product is required for Hedgehog signal transduction and the development of slow muscle identity. Development127, 2189-2199.
Barresi, M. J., D’Angelo, J. A., Hernandez, L. P. and Devoto, S. H.(2001). Distinct mechanisms regulate slow-muscle development.Curr. Biol. 11, 1432-1438.
Baxendale, S., Davison, C., Muxworthy, C., Wolff, C., Ingham, P. W. and Roy, S.(2004). The B-cell maturation factor Blimp-1 specifies vertebrate slow-twitch muscle fiber identity in response to Hedgehog signaling. Nat. Genet. 36, 88-93.
Bottinelli, R.(2001). Functional heterogeneity of mammalian single muscle fibres: do myosin isoforms tell the whole story? Pflugers Arch.443, 6-17.
Braissant, O. and Wahli, W.(1998). A simplified in situ hybridization protocol using non-radioactively labeled probes to detect abundant and rare mRNAs on tissue sections. Biochemica1, 10-16.
Bryson-Richardson, R. J., Daggett, D. F., Cortes, F., Neyt, C., Keenan, D. G. and Currie, P. D.(2005). Myosin heavy chain expression in zebrafish and slow muscle composition. Dev. Dyn.233, 1018-1022.
Buckingham, M.(2007). Skeletal muscle progenitor cells and the role of Pax genes. C. R. Biol. 330, 530-533.
Buller, A. J., Eccles, J. C. and Eccles, R. M.(1960). Interactions between motoneurones and muscles in respect of the characteristic speeds of their responses. J. Physiol. 150, 417-439.
Buller, A. J., Mommaerts, W. F. and Seraydarian, K.(1969). Enzymic properties of myosin in fast and slow twitch muscles of the cat following cross-innervation. J. Physiol. 205, 581-597.
Carvajal, J. J., Cox, D., Summerbell, D. and Rigby, P. W.(2001). A BAC transgenic analysis of the Mrf4/Myf5 locus reveals interdigitated elements that control activation and maintenance of gene expression during muscle development. Development128, 1857-1868.
Chen, Q., Moore, L. A., Wick, M. and Bandman, E.(1997). Identification of a genomic locus containing three slow myosin heavy chain genes in the chicken. Biochim. Biophys. Acta1353, 148-156.
Chen, W., Burgess, S. and Hopkins, N.(2001). Analysis of the zebrafish smoothened mutant reveals conserved and divergent functions of hedgehog activity. Development128, 2385-2396.
Cope, M. J., Whisstock, J., Rayment, I. and Kendrick-Jones, J.(1996). Conservation within the myosin motor domain: implications for structure and function. Structure4, 969-987.
Crow, M. T. and Stockdale, F. E.(1986). Myosin expression and specialization among the earliest muscle fibers of the developing avian limb. Dev. Biol. 113, 238-254.
Devoto, S. H., Melancon, E., Eisen, J. S. and Westerfield, M.(1996). Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development122, 3371-3380.
Feng, X., Adiarte, E. G. and Devoto, S. H.(2006). Hedgehog acts directly on the zebrafish dermomyotome to promote myogenic differentiation. Dev. Biol. 300, 736-746.
Glasgow, E. and Tomarev, S. I.(1998). Restricted expression of the homeobox gene prox 1 in developing zebrafish. Mech. Dev.76, 175-178.
Grimaldi, A., Tettamanti, G., Martin, B. L., Gaffield, W., Pownall, M. E. and Hughes, S. M.(2004). Hedgehog regulation of superficial slow muscle fibres in Xenopus and the evolution of tetrapod trunk myogenesis. Development131, 3249-3262.
Hadchouel, J., Carvajal, J. J., Daubas, P., Bajard, L., Chang, T., Rocancourt, D., Cox, D., Summerbell, D., Tajbakhsh, S., Rigby, P. W. et al.(2003). Analysis of a key regulatory region upstream of the Myf5 gene reveals multiple phases of myogenesis, orchestrated at each site by a combination of elements dispersed throughout the locus. Development130, 3415-3426.
Haddad, F., Bodell, P. W., Qin, A. X., Giger, J. M. and Baldwin, K. M.(2003). Role of antisense RNA in coordinating cardiac myosin heavy chain gene switching. J. Biol. Chem.278, 37132-37138.
Haines, L., Neyt, C., Gautier, P., Keenan, D. G., Bryson-Richardson, R. J., Hollway, G. E., Cole, N. J. and Currie, P. D.(2004). Met and Hgf signaling controls hypaxial muscle and lateral line development in the zebrafish. Development131, 4857-4869.
Hamade, A., Deries, M., Begemann, G., Bally-Cuif, L., Genet, C., Sabatier, F., Bonnieu, A. and Cousin, X.(2006). Retinoic acid activates myogenesis in vivo through Fgf8 signalling. Dev. Biol. 289, 127-140.
Hammond, C. L., Hinits, Y., Osborn, D. P., Minchin, J. E., Tettamanti, G. and Hughes, S. M.(2007). Signals and myogenic regulatory factors restrict pax3 and pax7 expression to dermomyotome-like tissue in zebrafish. Dev. Biol. 302, 504-521.
Hatta, K., Schilling, T. F., BreMiller, R. A. and Kimmel, C. B.(1990). Specification of jaw muscle identity in zebrafish: correlation with engrailed-homeoprotein expression. Science250, 802-805.
Hernandez, L. P., Patterson, S. E. and Devoto, S. H.(2005). The development of muscle fiber type identity in zebrafish cranial muscles. Anat. Embryol.209, 323-334.
Hernandez-Lagunas, L., Choi, I. F., Kaji, T., Simpson, P., Hershey, C., Zhou, Y., Zon, L., Mercola, M. and Artinger, K. B.(2005). Zebrafish narrowminded disrupts the transcription factor prdm1 and is required for neural crest and sensory neuron specification. Dev. Biol. 278, 347-357.
Higashijima, S., Okamoto, H., Ueno, N., Hotta, Y. and Eguchi, G.(1997). High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin. Dev. Biol. 192, 289-299.
Hirsinger, E., Stellabotte, F., Devoto, S. H. and Westerfield, M.(2004). Hedgehog signaling is required for commitment but not initial induction of slow muscle precursors. Dev. Biol. 275, 143-157.
Hollway, G. E., Bryson-Richardson, R. J., Berger, S., Cole, N. J., Hall, T. E. and Currie, P. D.(2007). Whole-somite rotation generates muscle progenitor cell compartments in the developing zebrafish embryo. Dev. Cell12, 207-219.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F.
(1995). Stages of embryonic development of the Zebrafish. Dev. Dyn.203, 253-310.
Korfage, J. A., Koolstra, J. H., Langenbach, G. E. and van Eijden, T. M.
(2005a). Fiber-type composition of the human jaw muscles-(part 1) origin and functional significance of fiber-type diversity. J. Dent. Res.84, 774-783.
Korfage, J. A., Koolstra, J. H., Langenbach, G. E. and van Eijden, T. M.
(2005b). Fiber-type composition of the human jaw muscles-(part 2) role of hybrid fibers and factors responsible for inter-individual variation. J. Dent. Res.
84, 784-793.
Lee, E. C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A., Court, D. L., Jenkins, N. A. and Copeland, N. G.(2001). A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics73, 56-65.
Lewis, K. E., Currie, P. D., Roy, S., Schauerte, H., Haffter, P. and Ingham, P. W.
(1999). Control of muscle cell-type specification in the zebrafish embryo by Hedgehog signalling. Dev. Biol. 216, 469-480.
Liang, C. S., Kobiyama, A., Shimizu, A., Sasaki, T., Asakawa, S., Shimizu, N. and Watabe, S.(2007). Fast skeletal muscle myosin heavy chain gene cluster of medaka Oryzias latipes enrolled in temperature adaptation. Physiol. Genomics
29, 201-214.
Lompre, A. M., Nadal-Ginard, B. and Mahdavi, V.(1984). Expression of the cardiac ventricular alpha- and beta-myosin heavy chain genes is developmentally and hormonally regulated. J. Biol. Chem.259, 6437-6446.
Mahdavi, V., Chambers, A. P. and Nadal-Ginard, B.(1984). Cardiac alpha- and beta-myosin heavy chain genes are organized in tandem. Proc. Natl. Acad. Sci. USA81, 2626-2630.
McGuigan, K., Phillips, P. C. and Postlethwait, J. H.(2004). Evolution of sarcomeric myosin heavy chain genes: evidence from fish. Mol. Biol. Evol.21, 1042-1056.
Murphy, C. T. and Spudich, J. A.(2000). Variable surface loops and myosin activity: accessories to a motor. J. Muscle Res. Cell Motil.21, 139-151.
Nakano, Y., Kim, R., Kawakami, A., Roy, S., Schier, A. F. and Ingham, P. W.
(2004). Inactivation of dispatched 1 by the chameleon mutation disrupts Hedgehog signalling in the zebrafish embryo. Dev. Biol. 269, 381-392.
Nihei, Y., Kobiyama, A., Ikeda, D., Ono, Y., Ohara, S., Cole, N. J., Johnston, I. A. and Watabe, S.(2006). Molecular cloning and mRNA expression analysis of carp embryonic, slow and cardiac myosin heavy chain isoforms. J. Exp. Biol. 209, 188-198.
Nikovits, W., Jr, Cann, G. M., Huang, R., Christ, B. and Stockdale, F. E.(2001). Patterning of fast and slow fibers within embryonic muscles is established independently of signals from the surrounding mesenchyme. Development128, 2537-2544.
Noden, D. M. and Francis-West, P.(2006). The differentiation and morphogenesis of craniofacial muscles. Dev. Dyn.235, 1194-1218.
Ono, Y., Liang, C., Ikeda, D. and Watabe, S.(2006). cDNA cloning of myosin heavy chain genes from medaka Oryzias latipes embryos and larvae and their expression patterns during development. Dev. Dyn.235, 3092-3101.
Page, S., Miller, J. B., DiMario, J. X., Hager, E. J., Moser, A. and Stockdale, F. E.(1992). Developmentally regulated expression of three slow isoforms of myosin heavy chain: diversity among the first fibers to form in avian muscle. Dev. Biol. 154, 118-128.
Pandorf, C. E., Haddad, F., Roy, R. R., Qin, A. X., Edgerton, V. R. and Baldwin, K. M.(2006). Dynamics of myosin heavy chain gene regulation in slow skeletal muscle: role of natural antisense RNA. J. Biol. Chem.281, 38330-38342.
Park, H. C. and Appel, B.(2003). Delta-Notch signaling regulates oligodendrocyte specification. Development130, 3747-3755.
Pownall, M. E., Gustafsson, M. K. and Emerson, C. P., Jr(2002). Myogenic regulatory factors and the specification of muscle progenitors in vertebrate
embryos. Annu. Rev. Cell Dev. Biol. 18, 747-783.
D
E
Prince, V. E., Joly, L., Ekker, M. and Ho, R. K.(1998). Zebrafish hox genes: genomic organization and modified colinear expression patterns in the trunk. Development125, 407-420.
Rauch, G. J., Lyons, D. A., Middendorf, I., Friedlander, B., Arana, N., Reyes, T. and Talbot, W. S.(2003). Submission and curation of gene expression data. ZFIN Direct Data Submission, http://zfin.org.
Rose, T. M., Schultz, E. R., Henikoff, J. G., Pietrokovski, S., McCallum, C. M. and Henikoff, S.(1998). Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences. Nucleic Acids Res. 26, 1628-1635.
Roy, S., Wolff, C. and Ingham, P. W.(2001). The u-boot mutation identifies a Hedgehog-regulated myogenic switch for fiber-type diversification in the zebrafish embryo. Genes Dev.15, 1563-1576.
Sacks, L. D., Cann, G. M., Nikovits, W., Jr, Conlon, S., Espinoza, N. R. and Stockdale, F. E.(2003). Regulation of myosin expression during myotome formation. Development130, 3391-3402.
Schilling, T. F. and Kimmel, C. B.(1997). Musculoskeletal patterning in the pharyngeal segments of the zebrafish embryo. Development124, 2945-2960.
Serbedzija, G. N., Chen, J. N. and Fishman, M. C.(1998). Regulation in the heart field of zebrafish. Development125, 1095-1101.
Shi, X. and Garry, D. J.(2006). Muscle stem cells in development, regeneration, and disease. Genes Dev.20, 1692-1708.
Shrager, J. B., Desjardins, P. R., Burkman, J. M., Konig, S. K., Stewart, S. K., Su, L., Shah, M. C., Bricklin, E., Tewari, M., Hoffman, R. et al.(2000). Human skeletal myosin heavy chain genes are tightly linked in the order embryonic-IIa-IId/x-ILb-perinatal-extraocular. J. Muscle Res. Cell Motil.21, 345-355.
Stellabotte, F., Dobbs-McAuliffe, B., Fernandez, D. A., Feng, X. and Devoto, S. H.(2007). Dynamic somite cell rearrangements lead to distinct waves of myotome growth. Development134, 1253-1257.
Stiassny, M.(2000). Muscular system. In The Laboratory Fish(ed. G. K. Ostrander), pp. 109-128. New York: Academic Press.
Szeto, D. P. and Kimelman, D.(2006). The regulation of mesodermal progenitor cell commitment to somitogenesis subdivides the zebrafish body musculature into distinct domains. Genes Dev.20, 1923-1932.
Tallafuss, A. and Bally-Cuif, L.(2003). Tracing of her5 progeny in zebrafish transgenics reveals the dynamics of midbrain-hindbrain neurogenesis and maintenance. Development130, 4307-4323.
Thisse, B., Pflumio, S., Fürthauer, M., Loppin, B., Heyer, V., Degrave, A., Woehl, R., Lux, A., Steffan, T., Charbonnier, X. Q. and Thisse, C.(2001).
Expression of the zebrafish genome during embryogenesis. ZFIN Direct Data Submission, http://zfin.org.
Thisse, C. and Thisse, B.(1998). High resolution whole-mount in situ hybridization. Zebrafish Sci. Monit.5.
van Eeden, F. J., Granato, M., Schach, U., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A. et al.(1996). Mutations affecting somite formation and patterning in the zebrafish, Danio rerio. Development123, 153-164.
van Raamsdonk, W., Pool, C. W. and te Kronnie, G.(1978). Differentiation of muscle fiber types in the teleost Brachydanio rerio. Anat. Embryol.153, 137-155.
Varga, Z. M., Amores, A., Lewis, K. E., Yan, Y. L., Postlethwait, J. H., Eisen, J. S. and Westerfield, M.(2001). Zebrafish smoothened functions in ventral neural tube specification and axon tract formation. Development128, 3497-3509.
von Hofsten, J., Elworthy, S., Gilchrist, M. J., Smith, J. C., Wardle, F. C. and Ingham, P. W.(2008). Prdm1 and Sox6 mediated transcriptional repression specifies muscle fibre type in the zebrafish embryo. EMBO Rep. (in press).
Weiss, A., McDonough, D., Wertman, B., Acakpo-Satchivi, L., Montgomery, K., Kucherlapati, R., Leinwand, L. and Krauter, K.(1999). Organization of human and mouse skeletal myosin heavy chain gene clusters is highly conserved. Proc. Natl. Acad. Sci. USA96, 2958-2963.
Weiss, S., Rossi, R., Pellegrino, M. A., Bottinelli, R. and Geeves, M. A.
(2001). Differing ADP release rates from myosin heavy chain isoforms define the shortening velocity of skeletal muscle fibers. J. Biol. Chem.276, 45902-45908.
Westerfield, M.(1995). The Zebrafish Book(2nd edn). Oregon: University of Oregon Press.
Wilm, T. P. and Solnica-Krezel, L.(2005). Essential roles of a zebrafish prdm1/blimp1 homolog in embryo patterning and organogenesis. Development
132, 393-404.
Winterbottom, R.(1974). A descriptive synonymy of the striated muscles of the Teleostei. Proc. Acad. Nat. Sci. Philadelphia125, 225-317.
Wolff, C., Roy, S. and Ingham, P. W.(2003). Multiple muscle cell identities induced by distinct levels and timing of Hedgehog activity in the zebrafish embryo. Curr. Biol.13, 1169-1181.
Xu, J., Srinivas, B. P., Tay, S. Y., Mak, A., Yu, X., Lee, S. G., Yang, H., Govindarajan, K. R., Leong, B., Bourque, G. et al.(2006). Genomewide expression profiling in the zebrafish embryo identifies target genes regulated by Hedgehog signaling during vertebrate development. Genetics174, 735-752.