Interleukin 4 activates a signal transducer and activator of transcription (Stat) protein which interacts with an interferon gamma activation site like sequence upstream of the I epsilon exon in a human B cell line Evidence for the involvement of Janus k

Interleukin 4 activates a signal transducer and

activator of transcription (Stat) protein which

interacts with an interferon-gamma activation

site-like sequence upstream of the I epsilon

exon in a human B cell line. Evidence for the

involvement of Janus kinase 3 and interleukin-4

Stat.

X Fenghao, … , D Diaz-Sanchez, A Nel

J Clin Invest.

1995;

96(2)

:907-914.

https://doi.org/10.1172/JCI118138

.

Germ line C transcripts can be induced by IL-4 in the human B cell line, BL-2. Utilizing a

IFN-gamma activation site-like DNA sequence element located upstream of the I epsilon

exon, we demonstrated by gel mobility shift assays that IL-4 induced a binding activity in the

cytosol and nucleus of BL-2 cells. This factor was designated IL-4 NAF (IL-4-induced

nuclear-activating factors) and was identified as a tyrosine phosphoprotein, which

translocates from the cytosol to the nucleus upon IL-4 treatment. Because these are the

characteristics of a signal transducer and activator of transcription (Stat) protein, we

determined whether antibodies to Stat proteins will interfere with gel mobility shift and found

that antibodies to IL-4 Stat, also known as Stat6, but not antibodies to other Stat proteins,

interfere with the formation of the IL-4 NAF complex. Congruous with the involvement of a

Stat protein, IL-4 induced robust Janus kinase 3 (JAK3) activity in BL-2 cells. Cotransfection

of JAK3 with IL-4 Stat into COS-7 cells produced an intracellular activity which bound the

same IFN-gamma activation site-like sequence and comigrated with IL-4 NAF in

electrophoretic mobility shift assay. These results show that IL-4 NAF is IL-4 Stat, which is

activated by JAK3 in response to IL-4 receptor engagement.

Research Article

Interleukin 4 Activates

a

Signal Transducer and Activator of Transcription

(Stat) Protein which Interacts with

an

Interferon-y Activation Site-like

Sequence Upstream of the 1 Exon

in

a

Human B Cell Line

Evidence

for the Involvement of Janus Kinase 3 and Interleukin-4 Stat

XuFenghao,*AndrewSaxon,*" AndrewNguyen,*Zhang Ke,* David Diaz-Sanchez,*andAndre Nel*I

*The Hartand Louise Lyon Laboratory, Division of Clinical Immunology and Allergy, Department of Medicine,

*The

MolecularBiology Institute, and

IThe

Jonsson Comprehensive Cancer Center, UCLA School of Medicine, University of California, Los Angeles, California 90024-1680

Abstract

Germ line

_CQ

transcripts can be induced by 1L-4 in the human B cellline, BL-2. Utilizing aIFN-y activation

site-like DNA sequence element located upstreamofthe

L

exon,

wedemonstrated by gelmobilityshift assays thatIL-4 in-ducedabinding activityinthecytosolandnucleus of BL-2 cells. This factor wasdesignated 1L4NAF (IL-4-induced nuclear-activating factors)andwasidentified as atyrosine

phosphoprotein, which translocatesfrom the cytosol tothe nucleus upon

11-4

treatment.Because these are the

charac-teristics ofasignaltransducer and activatorof transcription (Stat) protein, we determined whether antibodies to Stat

proteins willinterfere withgelmobility shiftandfoundthat

antibodiesto11-4 Stat,also knownasStat6,butnot antibod-ies to other Stat proteins, interfere with the formation of theIL-4NAFcomplex.Congruous withthe involvement of

aStatprotein,

1L-4

induced robustJanus kinase 3 (JAK3) activityinBL-2 cells.Cotransfection of JAK3with11-4 Stat into COS-7 cells produced an intracellular activity which bound the same IFN-y activation site-like sequence and

comigratedwith

1L-4

NAF inelectrophoretic mobility shift

assay. These results show that

1L-4

NAF is11-4 Stat,which is activated byJAK3in response to 1L-4receptor

engage-ment. (J. Clin. Invest. 1995. 96:907-914.) Key words:

in-terleukin-4-induced nuclear-activating factor * germlineX Immunoglobulin E-transcription -signaling

Introduction

IL-4 exerts pleiotropic effects on thefunction ofa variety of cell typesincludinglymphocytes, macrophages,fibroblasts,and endothelial cells (1).In Bcells,IL-4 isinvolved in cell

prolifer-ation and differentiprolifer-ation. Among the differentiprolifer-ation effects are

cell surface expression of MHC-ll and CD23

(FcRB)

gene products, as well as Ig heavy chain class switching to IgG1 and

AddresscorrespondencetoAndre Nel, Division of ClinicalImmunology and Allergy, Department of Medicine, 52-175 Center for Health Sci-ences, 10833 Le Conte Avenue, UCLA School of Medicine, Los

Angeles,CA90024-1680. Phone:310-825-6620;FAX:310-206-8107.

Receivedfor publication 10 January1995 andacceptedinrevised

form28April1995.

IgE (2-5). While inductionofproliferation appearsto involve

the phosphorylation of the substrate, 4PS/IRS-1, and

recruit-mentof the secondmessengersphosphoinositide 3-kinase (PI-3 kinase) and Grb2,not much is known aboutthepathways by which 11L-4directs cellular differentiation (6-9).

IgE isotype switching involves the sequentialstepsof

germ-line transcription followed by heavy chaingene rearrangement

(4, 5, 10). IL-4 induces germline transcription (4, 5, 10),while

IFN-'y inhibits the process ( 11 ).To examine ifIFN--yand IL-4 have either antagonisticoranalogous effectsontranscription,

an11L-4 inducedDNAbindingfactor which reacts with an IFN-y response element (also known as an IFN-,y activation site or

GAS'),

wasdemonstrated to be presentby electrophoretic mobility shift assays (EMSA) in the human monocytic cell line, Thp-1 (12). This factor,which interacts with an upstream

sequence in theFcR, gene, was named 1L-4-induced

nuclear-activatingfactor(IL-4 NAF) (see Fig.1A; 12).Ahomologous 9-bp sequencein thepromoterof theCD23genewasdescribed by Kohler and Rieber and designated 11L-4 nuclear-activated

factor(seeFig. 1A; 13).Inmurine Bcells,an IL-4-inducible factor which interacts with the initiation site of the germlineI,

exon, was designated signal-transducing factor of 11L-4 (STF-IL4) by Schindleretal. ( 14). Utilizing the

_FcYRI

probetopurify aninteractiveThp-I cell protein, Hou et al. have recentlycloned an IL-4-induced DNA binding factor which they designated

thesignal transducerandactivator oftranscription by IL-4

(IL-4Stat) (15). Statproteins are anovelfamily of transcription factorswhich, after phosphorylation and homo-or heterodimeri-zation in the cytosol, shuttletothe nucleus where they interact

withselect promoter sequences (16, 17). Althoughnotproven, it islikely that IL-4 NAF represents a homo- or heterodimerized version of 11L-4 Stat.

In addition to 11L-4 Stat, several of the Stat genes have

nowbeencloned, including

Statla/P

(p91 /p84), Stat2(p113), Stat3 (p89, acutephaseresponsefactor, APRF), Stat4 (p88),

and StatS (p90, mammary gland factor, MGF) (18-21). It

would appearas iftheconnection between Stat proteins anda

variety of activating receptors is based on the use of a novel

family oftyrosineproteinkinases also known as Janus kinase (JAK) (16, 17). Moreover, there appears tobe selectivity in the use ofJAK's and Stat proteins by specific receptors. For

instance, IFN-a utilizes JAK1 and Tyk2toactivate Statl and

1.Abbreviations used in thispaper: APRE,acutephase response ele-ment;EMSA,electrophoreticmobilityshift assay;GAS, IFN-y activa-tionsite;LL-4NAF, IL-4-inducednuclearactivatingfactor;JAK,Janus

kinase; PTK, protein tyrosinekinase; Stat, signaltransducer and

activa-toroftranscription.

J. Clin. Invest.

© The AmericanSocietyfor ClinicalInvestigation,Inc.

0021-9738/95/08/0907/08 $2.00

Stat2, while IFN-y utilizes JAKI andJAK2 to activate Statl (16, 17, 22). Recently, itwasreported thatIL-2and IL-4 acti-vate JAK3 in human T lymphocytes and NK cells (23, 24); thehomologous useof JAK3 by these twocytokinereceptors

isattributed to their sharing of a common y (Cy) subunit (25). Moreover, itappears asifJAK3 interacts directlywith

_Cy

and that JAK3 plays arole in signaling by the IL-4 receptor (26, 27).Taken together with the fact that IL-4 NAF and STF-IL-4areknown tobe tyrosine phosphoproteins, it is possible that they areJAK3 substrates (12, 14).

We chose a GAS-like element upstream ofthe human I,

exon as anelectrophoretic mobilityshiftassay(EMSA) probe

to demonstrate induction ofabinding factor, designated IL-4

NAF, in a human B cell line which undergoes germline

C,

transcription. This proteinis atyrosine phosphoprotein which

translocates from thecytosol to thenucleus, and which

comi-grates during EMSA with IL-4 Stat which has been activated inCOS-7 cells bycotransfection of JAK3.

Methods

Materials. Monoclonal antiphosphotyrosine antiserum (4G10) and

polyclonal anti-JAKI were from Upstate Biotechnology Inc. (Lake Placid,NY). Antibodiesrecognizing StatI(p9l)andStat 3 (p89)were

generouslyprovided byDr. ChrisSchindler, DepartmentofMedicine, ColumbiaUniversity,NewYork(14). Culture mediacomponentswere

fromHyClone Laboratories(Logan,UT)and M.A.Bioproducts (Walk-erswille, MD). [a32P]dCTPwerefrom ICN Biomedicals Inc.(Costa

Mesa,CA). Double-strandpoly(dI-dC)wasfromPharmacia LKB

Bio-technology Inc. (Piscataway, NJ). Salmon sperm DNA and Klenow fragment were fromStratageneInc.(LaJolla,CA). Human recombinant IL-4 andIL-6werefromR&DSystems(Minneapolis, MN).Plasmid

Maxiprepkit was fromPromegaCorp. (Madison, WI). pcDNA3 expres-sionvector wasfromInvitrogen(San Diego, CA).Thetyrosine phos-phatase, PTP-1C, was generously provided byDr. NickTonks (Cold SpringHarborLaboratory, ColdSpring Harbor, NY). Anti-JAK3

antise-rumandJAK3cDNAwas agift fromDr.JohnJ. O'Shea (Laboratory

ofExperimentalImmunology,National CancerInstitute, Frederick, MD;

23). IL-4 Stat cDNAand rabbit antiserumtoitsprotein productwere

generously provided by Dr. Steven L. McKnight (Tularik Inc., San

Francisco, CA; 15).ThehumanBL-2cell linewasgenerously provided byDr. Jan de Vries (DNAX Research Institute,PaloAlto, CA; 28). Thiscell lineproduces IgM and expresses germline C,in responseto

IL-4 treatment. COS-7 cells were generously provided byDr. Owen

Witte (HHMI,UCLA,LosAngeles, CA).All othermaterials wereof

thehighestpurity gradeavailable andwereobtained from Sigma Chemi-cal Co.(St. Louis, MO).

Cell culture. BL-2 cellswerecultured in RPMI-1640 medium

sup-plementedwith 10%FCS,2 mMglutamine,50U/mlpenicillinand50

U/mlstreptomycin (completemedium).COS-7 cellswerecultured in

DME,supplemented with 10%FCS, and 100Ueach ofpenicillinand streptomycin.

Cellular stimulation andextraction. Whole cell extractionwas per-formedasdescribedby Wegenkaetal.(29). Briefly,5 x 106 cells in 500

_,l

completemedium wereeithermock-treatedortreated with 20 ng/mlIL-4,100 U/mlIL-6, 100U/mlIL-2or100ng/mlPMAfor the indicated time periods at 37°C. Cells pellets were washed twice with ice-cold PBS and then lysed in 50 mM Tris/HCl, pH 8.0, 10 mM

3-(3-cholamidopropyl)-dimethyl-ammonio)-1

-propanesulfonate-(CHAPS),2mMEDTA, 100

pM

sodium orthovanadate, 5 mM NaF, 1 mMDTT,750 mMPMSF, 10

_pg/ml

eachofaprotinin,pepstatin, and

leupeptin.After 20 minat4'C,insoluble materialwasremoved at14,000 g for 5 min inamicrocentrifuge.

Cytosolic and nuclear extracts were performed as described

pre-viously with minor modifications (30). Briefly, 5 x 10' BL-2 cells

werelysedby freeze-thawingin100

_Al

hypotonicbuffer(10mMHepes,

pH 7.9, 1.5mMMgCl2, 0.2 mMPMSF, and 0.5mMDTI).Afterthree additionalfreeze andthawcycles,thelysateswereneutralized with100

,ul2xcytosolicbuffer(30mM

_{Hepes, pH}

7.9,40%

_glycerol,

190 mM

KCl, 0.4mMEDTA, 0.2 mMPMSF, 0.4 mMDTT, 2 mM NaF, 0.2 mM Na3VO4, 1 Ag/ml leupeptin, and 1

_ttg/ml

aprotinin) and spun

through a 40% sucrose cushion for 10 min at 3,000 g at4TC. The supernatantwastransferredinto afreshtubeandrespunat14,000 g for

10 min at 4TC. The supernatant was kept as cytosolic extracts. The

nuclearpelletwastransferredtofreshtubesandextractedbyvortexing

in 25,ulnuclearextractionbuffer (20mMHepes,pH7.9, 20%glycerol,

240mMKCl,1.5mMMgCl2, 0.1 mMPMSF, 1 mM EDTA and 0.1%

NP-40). Samples were spun at 14,000g for 10 min at 4°C and the supernatantswerecollectedasnuclearextracts.

Performance of EMSA. Double-stranded oligonucleotide probes usedintheEMSAwere asfollows: TheGAS-likesequence upstream

of the human I, exon (S1 oligonucleotide): 5'-GACTTCCCAAGA-ACAG-3' (31 ); IL-6acutephraseresponseelement(APRE) in the

a2-macroglobulinpromoter:5'-GATCCTTCTGGGAATTCCTA-3' (32);

IL-6response element in thec-jun promoter(JRE-IL6), 5'-GCGCTT-CCGACAGTGACGCGAGCCG-3' (33).Thecomplementary

oligonu-cleotide wasannealed and end-labeled with [32P]dCTP. 8

_MI

(5-10

Hg)of_cytosolic,nuclearorwhole cellextractwereincubated with 10 ml2x binding buffer (40% glycerol, 40mMTris/HCl, pH7.9, 100 mMKCl,2 mMEDTA,2 mMDTT, 0.1%NP-40, 50

,g/ml

poly-[dI-dC] )and 2₀₁(10,000 cpm) probe for 20min at room temperature and

then separatedon6% gels, whichweredried and autoradiographed.For

supershift, 6 pu cellextract wasmixed with 2p1 antibody before adding

bindingbufferandprobe.

Immunoprecipitationand Westernblot. After cytokine stimulation,

2 x 107 cellsin eachsamplewerelysedin200

_/1

lysis buffer (50mM

Tris, pH 7.4, 150 mMNaCl, 1%NP-40, 1 mMNa3VO4, 10mMNaF,

2 mMPMSF, 10

Mg/ml

leupeptin, 20,ug/mlaprotinin,0.5 mM EDTA) for 10 minat4°C.Afterpreclearing of lysatesat13,000g, the

superna-tants wereincubatedwith 5 p1antiserumtoJAKI orJAK3 for1 hat

4°C.Thiswasfollowedbytheaddition of 35 p1 ofa50%suspension

ofproteinA Sepharose beads foranother hour.After washingofthe

beads inlysisbufferminusEDTA, the pelletwasboiledwith sample bufferand separated by 8% SDS-PAGE. Proteins were transferredto

Immobilon-Pmembranes,whichwereoverlayed with1pg/ml antiphos-photyrosineantibodyand thendevelopedwithanECL protocolas rec-ommendedbythe manufacturer(AmershamCorp., Arlington Heights, IL). Plasmidconstructionand transienttransfections. JAK3cDNA was subcloned into the EcoRI site ofthepcDNA3 vector. IL-4 Statwas

subclonedinto thesameexpressionvectorviathe EcoRI andXhoIsites.

COS-7 cells weregrown to60% confluencyin 100-mmpetri dishes.

UtilizingtheCa3(PO4)2 method,these cellsweretransfected with either 15pgemptyvector, 5pgpcDNA3-IL4Stat,10pgpcDNA3-JAK3,or

bothpcDNA3-IL-4Stat andpcDNA3-JAK3.Salmon sperm DNAwas

usedtoadjustthetotalamountof DNAin each dish. 9 h after

transfec-tion, unincorporatedDNAwaswashed awaywithwarmHank's solution andreplacedwith 12 ml fresh DMEforafurther40-hculture. Whole cellextracts werepreparedasdescribed above.

Results

BL-2 cellscontain an IL-4-induciblefactorwhich bindsto a

GAS sequence which appears upstream ofthe

_I,

exon. BL-2

cells weretreated with IL-4 for timeperiods rangingbetween

1 and 15 min, and cellularextracts were assayed by EMSA

utilizing a 32P-labeled oligonucleotide corresponding to base

pairs

-153to -138(SI

oligonucleotide)

of the human

I,

pro-moter (Fig. 1 A). This sequence is homologous to the 9-bp

palindromic motif of the

Fc,,RI

promoter (Fig. 1 A), which binds IL-4NAF(13). WholeBL-2cellextractsshowedrapid

A

J ~~~~~~~~~~~~~~~200bp

-180 -170 -160 -150 -140 -130 -120

A C C X I=CGACTTCCAGGGCG

ACCAGCCTCACCTGRCCCC TTGICLCG&CTTCCAGAkGGA&GGCTCGGG

-110 -100 -90 -80 -70 -60 -50 -40

GCCCGGGCCTCCTGGGGTTCCCACCCCLTTTTTAGCTGAAAGCACTGAGGCAGRGCTCCCCCTACCCAGGCTCC

-30 -20 -10 0

ACTGCCC AXTCA CG CGTCLTCTGGG

+1

SI oligonudeotide:

FcRI:

CD23b:

IL6APRE:

Comptita

S-GAC AG-3'

5'-GTA GGAAC-3'(12)

5'-GGTGAAT GG3'(13) 5'-GATC CC-3' (33)

B

Smoe

<

L-4

L-4

Simulus:

A

_I

'

_I

_i

r

mOtit.

-0-

0

S2

SI JRE APRE

Time(min):

IL-4 NAF

Lane:

1

2

3

4

5

6

7

8

91011

(Fig. 1 B,lanes2-5). No shift complexwas seenduring treat-mentwith PMA (Fig. 1B, lane6),orexposureof BL-2 cells

toIL-2,IFN-y,orinsulin (notshown). The IL-4-induced com-plex was competed with excessunlabeled SI oligonucleotide, but not unlabeledS2oligonucleotide,whichcorresponds tothe region immediately adjacenttoSI (base pairs -174 to -152) (Fig. 1B, lanes 7-9). While anotherGAS sequence, the IL-6 responsiveAPRE(Fig.1 A),interfered with IL-4NAFbinding,

anon-GAS like IL-6 response element in thec-junpromoter, known asJRE-IL-6,hadnoeffectonIL-4NAFbinding (Fig.

1B,lanes 10 and11). 11L-6by itself failed, however,toinduce

a shift complex with S1 in BL-2 or any other cell type (not

Figure1.HL4induces anactivity which rec-ognizesaGAS-likesequence upstream of the humanIfpromoter in BL-2 cells. (A) The sequence upstream of the humanI,exon,

in-cluding thesiteused forconducting EMSA

(underlined),isshown. Basepairswere

numberedfromthe first initiationcodon

backwards.Below,the sequenceoftheSI oligonucleotideiscompared with IL-4 re-sponse elements in the promotersofFcRj

andCD23b,aswell as the IL-6 APRE. The

imperfect palindromescontained in these se-quences areunderlined. (B)Autoradiogram

ofEMSAconducted with theSI oligonucle-otide. 5 x 106BL-2 cells were mock

stimu-lated(control [Cont.])orstimulatedwith

100ng/mlPMA or20 ng/mlhuman recom-binant IL-4fortheindicatedtimeperiod.

Whole cell extracts werepreparedand EMSA was done asdescribedin Methods. TheIL-4-inducedbinding factor, designated

114NAF(lanes 1-5),was notinducedby

PMA(lane6).IL-4 NAF was competed for

bya100-foldexcessof unlabeledSI (lane 9),but not unlabeled sequence 2(S2),which

correspondstobasepairs-174 to -152

(lane 8).While anE-26 specific-likeIL-6 responseelementinthejunB promoter

(JRE)failed to competewithIL-4 NAF(lane 10),theGAS-likeIL-6 response element, also knownasthe APRE,didcompetefor binding (lane11).

shown). IL-4NAFactivitywas also inducedby IL-4 in

EBV-transformed B cell lines which also undergo germ-line

_C,

tran-scriptionupon IL-4 treatment (not shown). Monoclonal

anti-bodies to CD40, a receptor known to enhance IL-4-induced

germline

C,

transcription, did notactivate

1L-4

NAF activity (notshown).

IL-4 NAF is a tyrosinephosphoproteinwhichtranslocates fromthecytosoltothenucleusofBL-2cells. IL-4NAFactivity

was induced in BL-2cells in thepresenceofcyclohexamide,

which isconsistent with theposttranslationalmodification ofa

preformed factor (not shown). The type of posttranslational

phosphory-A

0

Genistein: 0

IL-4NAF

I--IL-4

l

l

0 100 25 5

1

2

3

4 1 2 3 4 5 6

Figure 2. IL-4 NAF induction and bindingto the Si oligonucleotideisdependentonprotein tyrosine phosphorylation. 5 x 106 BL-2 cellswere

precultured with varyingamountgenistein for2 hat370Cbeforestimulation with20ng/mlIL-4 for10minat370C. Control cultureswerestimulated with IL-4 without prior genisteinexposure.Whole cellextractswereused forconducting EMSA. Insomevials, 10 Migofextractwaspreincubated with 1 _{yg 4G10 (antiphosphotyrosine),}or 1 _{pg OKT-3 (isotype control), before addition of the probe.}Inanothersetof vials 10 Mgofextract

wasincubatedwith 1 MgPTP-1C,atyrosine phosphatase, for 30 minat30'Cinabsenceorpresenceof1 MMNa3VO4,atyrosine phosphatase inhibitor,or10 MMNaF,aserine/threonine phosphatase inhibitor. (A) EMSA showing inhibitory effect of genisteinon11L-4 NAF induction. (lane 1) Nonstimulated control (Cont.); (lanes 2-5) 11L-4 stimulationafterpreloading with genisteinattheindicated dose (MM). (B) EMSA showing inhibitory effect of antiphosphotyrosinemAb(4G10) onIL4 NAF bindingtotheS1 oligonucleotide. (lane 1) Nonstimulated control; lanes 2-4) 11L-4 stimulation andpretreatmentofthecellextractwithnoantibody,4G10orOKT3. (C)EMSAshowing inhibitory effect of tyrosine phosphatase PTP-lConthe binding activity of 1L-4NAFtotheS1 oligonucleotide. (lane 1) Nonstimulated control; (lane 2) IL-4 stimulated; (lane 3)

IL-4-stimulated whole cellextractsplusPTP-IC;(lane 4) plusbothPTP-1C andNaF;(lane 5) plusbothPTP-ICandvanadate; (lane 6) plusPTP-1C

andbothvanadate and NaF.

lation based on the following observations. First, the protein

tyrosine kinase (PTK) inhibitor, genistein, interfered with in-duction of IL-4 NAF in BL-2 cells inadose-dependentfashion

(Fig.2A).Similar observationsweremade withasecond PTK

inhibitor, erbstatin. Second,wedemonstrated thatIL-4NAFis a tyrosine phosphoprotein as determined by prevention of a

shiftcomplexwhencelllysateswerepriorincubated with

anti-phosphotyrosine antibodies (Fig. 2 B, lane 3). In contrast to

supershiftinducedduringEMSA with4G10,noshiftwas seen

with anunrelated monoclonal antibody (OKT3) of the same

isotype (Fig.2B,lane4). Third, weshowed that the phospho-tyrosylresiduesonIL-4NAFarerequiredfor DNAbindingby determiningthe effect ofaprotein tyrosine phosphatase,

PTP-IC onalready activated IL-4 NAF: PTP-1Cabrogated the for-mationofashiftcomplexwhen nuclearextractswereexposed

to thisenzyme before conducting EMSA (Fig. 2 C, lane 3).

To insure that the loss of DNA binding was a result of the

action ofthetyrosine phosphatase,we included sodium

ortho-vanadate, a tyrosine phosphatase inhibitor, and NaF, a serine

threonine phosphatase inhibitor, with thereactions. While

so-diumorthovanadatenegatedtheeffect ofPTP-1Con IL-4NAF

binding,NaF didnot exertanyeffect(Fig.2 C, lanes 4-6).

SinceIL-4NAF isatyrosinephosphoproteinwhich interacts with aGASsequence,this raisedthepossibilitythat this factor belongs tothe Stat protein family.These factors are

phospho-proteins which bind withvarying affinity to aseries of

GAS-likeelementsandareknowntocommunicateinformation from

severalcytokinereceptorstothenucleus afterhomo-or

hetero-dimerization in thecytosol ( 16).Totestifsimilartranslocation

can be demonstrated in BL-2 cells, nuclear and cytoplasmic

extracts were prepared for analysis by EMSA. The results,

whicharedepictedinFig. 3,showthat whileIL-4NAFactivity

was rapidly induced in both the cytosol and the nucleus, the

increase in cytosolic activity (1 min) preceded the major

in-crease in nuclear activity (2 min) (Fig. 3). This latency is

compatiblewithactivation in thecytosol,followedby transloca-tiontothe nucleus.

IL-4 induces robust tyrosine phosphorylation of JAK3 in BL-2 cells. The induction oftyrosinephosphorylation of Stat

proteins requirestheparticipationofafamilyofPTK's, namely

theJAK's(17).Itwouldappearasifselectcytokinereceptors

usespecificcombinations of JAK'stoactivateone or moreStat

proteins (16, 17). It has recently been shown that the 11-4

receptor in T lymphocytes and NK cells activate JAK3 (23, 24). BL-2 cellswere treated with IL-4 for various lengths of

time,andimmunoprecipitation performedforJAKI and JAK3. Thesecomplexeswereanalyzed by antiphosphotyrosine

immu-noblotting.While IL-4 inducedrelatively weaktyrosine phos-phorylationofJAKI in BL-2cells(Fig.4A, lanes2-6),there

was arobustactivation ofJAK3 (Fig.4 B, lanes2-6).

IL-4-induced JAK3phosphorylation wassuppressed by genisteinat

doses >25 MM, which is in agreementwith the effect of this

B

IL-4:

4G10:

OKT3:

~~

F

_DO

+ + +

- +

-- - +

C

IL-4

NAF

IL-4: PTP1C: Vanadate:

NaF:

IL-4 NAF -_

* I+

A

+ + +

+ + + +

Cytomol

Nuleus

II0I

lime(mhi): 0 1 2 3 5 10 0 1 2 3 5 10

IL-4NAF

-A

Cd NM

Tnm(mln): 0

198

116 86

BL-2

0515 30 60

0 5 15 30 60

in

Lane: 1 2 3 4 5 6 7 8 9 10 11 12

Figure 3. L-4 NAF activityisinducedinboth thecytosoland the

nucleusby IL-4.BL-2cellsweremocktreated(lanes and7)or stimulated with 20ng/ml IL-4forthe indicated timeperiods (lanes

2-6and8-12). The cytosolicand nuclearextractswerepreparedas described(31). Lactic dehydrogenase activitywascheckedtoshow thattherewas nocytosoliccontamination of nuclearextracts. 10_Agof eachextractwasexaminedbyEMSAutilizingtheSI oligonucleotide asprobe. Notice theappearanceofaprominentshiftband inthecytosol

at1min (lane 2),apointatwhich nuclearactivityisbarelynoticeable

(lane 8).

inhibitoroninductionof LL-4 NAFactivity (not shown).PMA

failedtoactivate JAKI orJAK3 in BL-2 cells (Fig.4A, lane

7; Fig. 4B, lane 7). In contrastto IL-4, IL-6 induced robust

tyrosine phosphorylation of JAKI but notJAK3 in the IL-6 responsiveB cell line, AF-10 (Fig. 4,AandB, lanes 8 and9). IL-4failedtoinducetyrosine phosphorylationofJAK2 in BL-2cells (datanotshown).

Taken together with thedata inFigs. 2 and3,thefindings

inFig.4stronglysuggestthatIL-4NAFisaStatproteinwhich

operatesdownstream of JAK3 in BL-2 cells.During conducting

ofEMSA, antisera toStatl (Fig. 5), Stat2 (not shown), and Stat3(Fig. 5)failedtoblockthe shiftof theIL-4NAFcomplex.

Arabbitantiserum toStat6did, however,block theformation of this DNA-protein complex as shown in Fig. 5 (lane 3).

Moreover, antiphosphotyrosine immunoprecipitatesfrom BL-2

cells, showed induction of 100- and 130-kD phosphoproteins by IL-4 onantiphosphotyrosine overlay (Fig. 6). Whilep130

likelyrepresents activated JAK3, plO0 is the exact molecular

weightofIL-4 Stat, also knownas Stat6.

Transfection ofJAK3 and IL-4Statinto COS-7 cellsinduces

aDNAbinding activitywhichcoelectrophoreseswithIL-4 NAF. To establish that JAK3 can activate 1L-4 NAF,we attempted

overexpressionofJAK3 in BL-2 cells withoutsuccess.We did succeed,however, intransfectingCOS-7 cells with JAK3 and could demonstrate that the transfected kinase is constitutively tyrosine phosphorylated (not shown).OncotransfectingJAK3 with IL-4 Stat, we were able to show by EMSA that an SI

oligonucleotide binding activity isgenerated in thecytosolof COS-7 cells (Fig. 7, lane 6). Moreover, this shift complex comigratedwith 11-4 NAF from BL-2 cells(Fig. 7,lanes 1 and 2). No shiftcomplexeswereinduced inCOS-7 cells transfected

withempty vector,JAK3cDNAor11-4Stat cDNAonly (Fig.

40-5

30

-L:M 1 2 3 4 5 6 7 8 9

FP NIS alAKI I

B

CellIke

Tlme(mkd): 0

BL-2

IL03

O 5 1 5 30 60

AF-10

I

I

I

IL-6

I

5 0 5

198

116

86

-66

a

40..S

30

Lan: 1 2 3 4 5 6 7 8 9

R: NIS ILAK3 I

Figure4.Tyrosine phosphorylationofJAK1 andJAK3inresponseto

IL4treatment.2x I07BL-2cells andAF-10 cellsweremocktreated (control [Cont.])orstimulatedwith 20ngn/mlhumanrecombinant IL-4,100ng/mlPMAor100U/mI human recombinantIL-6forthe indi-catedtimeperiod.Celllysateswereprecleared by centrifugationat

13,000gfor10min andwereimmunoprecipitatedwith either5_Isl anti-JAKIor5 anti-JAK3 antibody. Proteinswereseparatedon8% SDS-PAGEand thephosphorylationof JAKI and JAK3 assessedby antiphos-photyrosine immunoblottingasdescribed in Methods.AF-1Oisahuman

IgE producing myelomacell line whichrespondstoIL-6treatmentwith increasedproliferation. (A) Antiphosphotyrosineimmunoblotof JAKI

immunoprecipitates. (B) Antiphosphotyrosineimmunoblot of JAK3

immunoprecipitates. IP, immunoprecipitation; NIS,nonimmune serum.

_ JAK3

AF-l0

-1

r--§ L-6

5 0 -5

^)ii-L >

m

_- JAK1

Cellline: BL-2

Figure

5.Antibodiesto

F Stat6, but not Statl and

Stimulus: o ILK Stat3, interfere with the

[| I formation of the IL-4

r~t NAFcomplexin BL-2 Antibody: o O i " ; j; b cells. 5 x 106 BL-2 cells

orAF-10 cells were

ei--+ *sty* -¢t~f*4t~vo + ' ^ ther mock stimulated or

stimulated with 20

ng/ml

ILANAF _ IL-4for 10 minat37(C.

Nuclear extracts were prepared and examined

byEMSA with labeled

SI asdescribed. 2

/d

of anti-Statl(STATi), Stat3 (STAT3), anti-Stat6 (STAT6), or

non-immune serum (NIS)

wereused togetherwith 6 y1 cellular extract to

at-temptsupershiftorblock

theprotein-DNA inter-action. Unstimulated cells(lane 1);

IL-4-stimulatedcells,no

pre-incubation with

antise-Probe:S1 rum (lane 2); preincuba-tion with anti-Stat6(lane

3);preincubationwith rabbit nonimmuneserum(NIS;lane4);

preincu-bation withanti-Stat3 (lane 5);preincubationwithanti-Statl (lane 6); preincubation with control(OKT3)mAb(lane 7).

7,lanes 3-5). These results strongly suggest, that IL-4 Stat is activated by JAK3, whereupon this transcription factor binds

tothesame siteasIL-4 NAF.

Discussion

Inthis paperwe show thatIL-4inducesatyrosine

phosphopro-tein, IL-4 NAF, which interacts withaGAS sequence upstream of the humanI,exon.IL-4 NAFactivityincreases in thecytosol

beforeappearingin thenucleus, which iscompatible with cyto-sol-to-nuclear translocation. IL-4 NAF is identicaltoIL-4 Stat,

Fan bk)t:

anti-PY

Figure 6. IL-4 induced

protein tyrosine

phos-dl phorylationof 130- and

Stimulus: i! f00-kD_I proteins in

hu-185 f manBL-2 cells.Cell

__ ~~~stimulationand

immuno-1-'-pl

30 _{precipitation procedures}

were asdescribed inFig.

82 - A t 4, with the exception that

5jL 4G10wasused.

Pro-teinswereresolvedby

68 - _8%

SDS-PAGE and anti-_

p55

phosphotyrosine

immu-53 noblottingperformed

with 1

_/g/ml

4G10.

A: 1 2 3 (lane 1) nonstimulated

cells; (lane 2)

LL-4-stimulated cells; (lane 3)PMA-stimulated cells. Notice induction of

p130and

plO0

byIL-4andp55 byPMA.

BL-2 COS-? Figure 7.EMSA

com-L- -*A:m

+-

- - _{paring induction ofSI} pd3O *'aCtw: - . + - .

p~ LAe So - ._{- + - +} bonding activityin

pcM-JAK

_ - + +

_JAK3/IL-4

_Stat

cotrans-_ ; sfected COS-7 cells and

L-4 _

_BLASE

_IL-4-treated

_BL-2cells.

BL-2 cells were

stimu-lated with IL-4 for 10

minand whole cell ex-tractswere

_prepared

as describedinFig. 1. COS-7cells were transfected with emptypcDNA3

vector,JAK3 cDNA, IL-4StatcDNA, or a combi-nation of JAK3 + IL-4

Low9

1 2 3 4 5 6 Stat.Whole cell extract

wasprepared as

de-scribedfor BL-2 cells. Both cellular extracts were used to conduct

EMSAwith labeled S1 oligonucleotideasdescribed in Fig. 1 B. Acti-vated IL-4 Stat and IL-4 NAF comigrated.

a novel memberof the Statfamily which recognizes the same GAS afteractivation by JAK3 inacotransfected COS-7 cell line. Ourstudy shows that the IL-4 response element in human

I,promoter ishomologoustothe responseelement characterized by Kohler and Rieber (13), Kotanides and Reich (12), and Schindleretal. ( 14). Kohler and Rieber identified the so-called NF-1L4 which interacts with a 9-bp motif (5 '-TTCTAAGAA-3') in the human CD23b gene promoter (13; Fig. 1A). Kotan-ides and Reich described induction of IL-4 NAFin a human monocytic cell line, Thp-1, which recognizes a GAS in the promoter of the human

FcYRI

gene (12; Fig. IA). Thisfinding iscompatible with the ability of Stat proteinstodisplay varying

affinityforaseries of GAS-like elements( 16, 17). It is interest-ing that the IL-6-induced GAS response element in the

pro-moterof thea2-macroglobulingene(32)competes forbinding

of IL-4 NAFtothe S1 oligonucleotide (Fig. 1 B). IL-6failed, however,toinduceamobilityshiftcomplexwith the S1

oligo-nucleotide. The IL-4 NAF motif contains an inverted GAA repeatonoppositestrands (12),similartoother IL-4 response elements in the

FcR11a

(34),human

FcRb

(35), murine C 1

(36),murine

CQ

(37),murineMHCIIEJ3 (38),human

MHCII-DRa(38), and human

_FcYRI

genes(38) (Fig. 1A). Schindler

etal. identified the so-calledsignal transducing factor for IL-4

(STF-IL4) which interactswith aGAS sequence in the IRF-1 gene promoter as well as an upstream element (RI/R2

se-quence) in the murine

I,

promoter(14). Interestingly, theR / R2nucleotide doesnotcontain the inverted GAA repeat.

IL-4 NAF requires to be phosphorylated ontyrosine resi-due(s) tobindto theS1 oligonucleotide (Fig. 2 B).Boththe in vitro removal ofphosphate groups from tyrosine residues (Fig. 2 C) as well as the in vivo interference with tyrosine

phosphorylation(Fig.2A)abrogatedIL-4NAFactivity.These

characteristics, togetherwith the feature thatIL-4 NAFis acti-vated in both thecytosol and nucleus (Fig. 3), strongly sug-gestedto usthatIL-4 NAFisaStatprotein(16, 17). Moreover, thedelay by which nuclear activityis induced with respectto

thecytosolic increase suggests intracellular translocation from the cytosol to thenucleus, which is another characteristic of

recently purified and cloned the gene of a new Stat protein, which was designated IL-4 Stat, also known as Stat6 (15).

Utilizinganantiserum toStat6, we wereableto show that the IL-4 NAF complex could be supershifted/blocked, proving that IL-4NAF= 1L-4Stat = Stat6(Fig. 5). Moreover, we demon-strated 1L-4-induced phosphorylation ofa 100-kD protein in BL-2cells, which is the identical molecular weight of IL-4 Stat

(Fig. 6).

Statprotein activation involves the JAK family, which cur-rently consistsof four members, JAKI, JAK2, JAK3, and Tyk2 (16, 17). It would appear as if differential association of one or moreof these kinases with theactivatingreceptor may deter-mine which Statproteins are activated. For instance, Statl acti-vation by IFN-,y requires both JAK1 and JAK2toactivateStatl, while Statl andStat3 activation by the IL-6 receptor requires JAK1, JAK2, and Tyk2 (16, 17). Recentlyit was shown that IL-2, 11-4, IL-7, andIL-9 activate JAK3, and that this ability is dependent on their sharing of a common signaling subunit,

CY,

which is physically complexedto JAK3 (23-27). More-over,IL-4 has been showntoinduce thetyrosine phosphoryla-tion of JAK3 in T cells and NK cells (23, 24). The tyrosine

phosphorylationofJAK's is indicative of their activation. Simi-larly, in BL-2cellswefound robust induction oftyrosine phos-phorylation of JAK3 by1L-4 inassociation with weak JAK1

phosphorylation (Fig. 4). It is possible that JAK1 associates with the ligand-binding 140-kD subunit of the IL-4 receptor and contributetothe activation of JAK3 when theformer binds

to

_CY.

Altogether, these findings suggest that JAK3 is the PTK whichis directly involved in activation of IL-4NAF.To prove this notionmoredirectly,weinitially attemptedtooverexpress JAK3 in BL-2cells, but didnotsucceed. Asanalternative,we

cotransfected JAK3 and IL-4 Stat cDNAconstructsinto COS-7cells. This has resulted in activation ofacellularproteinwhich bound the S1 oligonucleotide sequence (Fig. 7). Moreover, thiscomplex comigrateswithIL-4 NAF(Fig.7). Because this

complexwasabsent from cells whichweretransfected by JAK3

orIL-4Stat only,it is reasonableto assumethat JAK3actually

modified the cotransfected IL-4 Stat protein. The exact molecu-lar details of the interaction between the kinase and the Stat protein and the involvement of the IL-4 receptor needs tobe

furtherstudied.

Insofarasgermline Cftranscription is important in the sub-sequenteventof IgE gene rearrangement, it is likely that Stat6 playsarole inIgE production inBlymphocytes. Whether

bind-ing of IL-4NAF to the

I,

upstream siteactually leadsto

tran-scriptionalactivation is unclear. Mutational alteration of critical basepairsin the9-bppalindromic motif of the CD23 promoter

disruptedIL-4-inducedactivation of a luciferase reporter gene

construct( 13 ). When the sequence upstream of the

I,

promoter shown inFig. 1 Awaslinkedto aluciferasereporter gene and transfected into BL-2cells, we found that IL-4 alone induced weak(twofold) stimulation of luciferase activity (not shown). This is in agreement with the relatively weak activation of a

related luciferase construct transfected into DG75 and BL-2 cells by Albrecht et al. (39). In the presence of anti-CD40

antibodies,however,wefoundthat IL-4 stimulatedadefinitive increase (eightfold) in luciferase activity in transiently transfected BL-2 cells (notshown).CD40 is knownto deliver

asignal which synergizeswith the IL-4 activationpathway in human B lymphocytes undergoing

CQ

rearrangement (40, 41). CD40ligation failed, however, to activateIL-4 NAF and did not exertadditional effects on IL-4 NAF activation by IL-4 (not

shown). The exact role of 11L-4 NAF on germline transcription needs to be studied further.

Acknowledgments

This work was supported by the U.S. Public HealthService,grants

AT-15251 andAI-34567 (UCLA Asthma, Allergy andImmunologic Dis-easeCenterfundedby theNationalInstitute ofAllergy and Infectious

Disease and the National Institute of Environmental HealthSciences).

References

1.Paul, W. E.1991.Interleukin 4: aprototypicimmunoregulatorylymphokine. Blood. 77:1859-1870.

2.Noelle, R.,P.H.Krammer,J.Ohara,J. W.Uhr, and E. S. Vitetta. 1984. IncreasedexpressionofIa antigensonrestingBcells: an additional role for B-cellgrowth factor.Proc. NatL.Acad.Sci. USA. 81:6149-6153.

3. Conrad,D.H.,T. J.Waldschmidt,W. T.Lee, M.Rao, A.D. Keegan, R. J.Noelle,R. G.Lynch,and M. R.Kehry.1987.Effects of B cellstimulatory

factor-i(interleukin4) onFc,andFc7receptorexpressiononmurine B lympho-cytes and B cell lines. J. Immunol. 139:2290-2296.

4.Vercell, D.,and R. S. Geha. 1989.RegulationofIgEsynthesisin human. J. Clin. Immunol. 9:75-83.

5.Gauchat, J.-F.,D. A.Lebman,R. L. Coffman,H.Gascan,and J. E. de Vries.1990. Structure andexpressionofgermlineetranscriptsin human B cells inducedbyinterleukin 4 to switch to IgEproduction.J.Exp.Med. 172:463-473. 6. Keegan,A.D.,K.Nelms,L. M.Wang,J. H.Pierce,and W. E.Paul.1994. IL-4receptor:signalingmechanisms. Immunol.Today. 15:423-431.

7. Keegan, A. D.,K. Nelms,W. Morris, L. M. Wang, J. H. Pierce, and W.E. Paul. 1994. An IL-4 receptor region containing an insulin receptor motif is important for IL-4-mediated IRS-1 phosphorylation and cell growth. Cell. 76:811-820.

8. Izuhara, K.,and N. Harada. 1993. Interleukin-4(IL-4) inducesprotein tyrosine phosphorylationof the IL-4 receptor and association of phosphatidylinosi-tol 3-kinase to the IL-4 receptor in a mouse T cellline, HT2. J. Biol. Chem. 268:13097-13102.

9.Skolnik,E.Y.,C. H.Lee,A.Batzer,L. M.Vicentini,M.Zhou,R.Daly, M. J.Myers,J. M.Backer,A.Ullrich,M. F.White,and J.Schlessinger.1993.The SH2/SH3domain-containing proteinGrb2 interacts withtyrosine-phosphorylated IRS1 and Shc:implicationsforinsulincontrolof rassignaling.EMBO (Eur. Mol. Biol.Org.)J. 12:1929-1936.

10.Lebman,D.A.,and R. L.Coffman.1988. Interleukin 4causesisotype switchingtoIgEin T cell stimulated clonal B cell culture. J.Exp. Med. 168:853-862.

11.Lixing, X.,and P. Rothman. 1994.IFN-yrepressesEgermline transcription andsubsequently down-regulatesswitch recombination toe.Int. Immunol. 6:515-521.

12.Kotanides, H.,and N.C. Reich. 1993.Requirementoftyrosine phosphory-lation forrapidactivation of a DNAbindingfactorbyIL-4. Science(Wash.DC).

262:1265-1267.

13.Kohler, I.,and E. P. Rieber. 1993.Allergy-associatedIf andFcE receptor H(CD23b)genes activated viabindingof aninterleukin4induced transcription factor to a novelresponsiveelement. Eur. J.Immunol. 23:3066-3071.

14.Schindler, C.,H.Kashleva, A.Pernis,R.Pine, and P. Rothman. 1994. STF-IL-4:anovelIL-4inducedsignal transducingfactor. EMBO(Eur.Mol.Biol. Org.)J. 13:1350-1356.

15.Hou,J.Z.,U.Schindler,W. J.Henzel,T.C. Ho,M.Brasseur,and S. L. McKnight. 1994.Aninterleukin-4-inducedtranscriptionfactor: IL-4 Stat. Science (Wash. DC).265:1701-1706.

16. Darnell,J.E., Jr., I.M.Kerr,andG. R. Stark. 1994.Jak-STAT pathways andtranscriptionalactivation in response to IFNs and other extracellularsignaling proteins.Science(Wash. DC).264:1415-1421.

17.Ihle,J.N.,B. A.Witthuhn,F. W.Quelle,K.Yamamoto,W. E.Thierfelder, B.Kreider,and0.Silvennoinen. 1994.Signaling bythecytokinereceptor

super-family:JAKsandSTATs.TIBS(TrendsBiochem.Sci.) 19:222-227. 18.Fu,X.-Y., C.Schindler,T.Improta, R.Aebersold,and J. E. Darnell Jr. 1992. Theproteinsof ISGF-3: the interferon a-inducedtranscriptional activator, defineagenefamilyinvolved insignaltransduction. Proc.Natl.Acad. Sci. USA. 89:7840-7843.

19.Akira,S.,Y.Nishio,M.Inoue,X. J. Wang,S.Wei,T.Matsusaka, K. Yoshida, T.Sudo, M.Naruto, and T. Kishimoto. 1994. Molecularcloning of APRE,anovelIFN-stimulatedgene factor 3p91-relatedtranscriptionfactor in-volved in thegpl30-mediatedsignaling pathway.Cell. 77:63-71.

20.Zhong, Z.,Z.Wen,and J. E.Darnell,Jr. 1994.Stat3 and Stat4: members of thefamilyofsignal transducers and activators oftranscription. Proc. Natl. Acad. Sci. USA. 91:4806-4810.

(MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. EMBO (Eur. Mol. Biol. Org.) J. 13:2182-2192.

22. Shuai, K. 1994. Interferon-activated signal transduction to the nucleus. Curr. Opin. Cell Biol.6:253-259.

23. Johnston, J. A., M. Kawamura, R. A. Kirken,Y.-Q. Chen, T. B. Blake, K.Shibuya, J. R. Ortaldo, D. W. McVicar, and J. J. O'Shea. 1994.Phosphorylation and activation ofJAK-3Janus kinase in response to interleukin-2. Science(Wash. DC).370:151-153.

24.Witthuhn,B.A.,0. Silvennoinen, 0. Miura,K. S.Lai,C.Cwik,E. T. Liu,and J. N. Ihle. 1994. Involvement of the Jak-3 Janus kinase insignaling by interleukins 2 and 4 in lymphoid and myeloid cells. Science (Wash. DC). 370:153-157.

25. Russell, S. M., A. D. Keegan, N. Harada, Y. Nakamura, M. Noguchi, P. Leland, M. C. Friedmann, A.Miyajima,R. K. Puri, W. E. Paul, and W. J. Leonard. 1993.Interleukin 2 receptor y chain: a functional component of the interleukin-4 receptor. Science(Wash.DC). 262:1880-1883.

26.Russell, S. M., J. A. Johnston, M.Noguchi,M.Kawamura, C. M. Bacon, M.Friedmann, M. Berg, D. W.McVicar,B. A.Witthuhn,0.Silvennoinen,et al. 1994.Interaction ofIL2R13and y, chains with Jakl and Jak3:implications for XSCID and XCID. Science(Wash.DC). 266:1042-1045.

27.Miyazaki,T., A.KawAhara,H.Fujii,Y.Nakagawa,Y.Minami,Z. J.Liu, I.Oishi, 0. Silvennoinen, B. A. Witthuhn, J. N. Ihle, and T. Taniguchi. 1994. Functional activation ofJakland Jak3byselective association with IL-2 receptor subunits. Science (Wash. DC).266:1045-1047.

28.Gauchat,J.-F., H.Gascan, R.de W.Malefyt,and J. E. de Vries. 1992. Regulationofgerm-line e transcriptionand induction of eswitching incloned EBV-transformedandmalignanthuman B cell linesby cytokinesandCD4+T cells. J. Immunol. 148:2291-2299.

29.Wegenka,U. M., C.Liitticken,J.Buschmann, J. Yuan, F.Lottspeich,W. Muller-Esterl, C. Schindler, E. Roeb, P. C. Heinrich, and F. Horn. 1994. The interleukin-6-activated acute-phaseresponse factor isantigenicallyand function-allyrelated to members of thesignaltransducer and activator oftranscription (STAT) family.Mol. Cell. Biol. 14:3186-3196.

30.Chodosh, L. A.1990.DNA-proteininteractions. InCurrent Protocols in Molecular Biology,Vol. 2. F. M.Ausubel,R.Brent, R. E.Kingston,D. D.Moore, J.G.Seidman,J. A.Smith,and K.Struhl,editors. GreenePublishingAssociates andWiley-Interscience.JohnWiley&Sons,New York. pp. 12.1.1-12.1.9.

31. Mills, F. C., J. S. Brooker, and R. D. Camerini-Otero. 1990. Sequences of human immunoglobulin switch regions: implications for recombination and transcription.Nucleic Acids Res. 18:7305-7316.

32. Wegenka, U. M., J. Buschmann, C. Lftticken, P. C. Heinrich, and F. Horn. 1993. Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level.Mol. Cell. Biol. 13:276-288.

33. Nakajima, K., T. Kusafuka, T. Takeda, Y. FuJitani, K. Nakae, and T. Hirano.1993. Identification of a novel interleukin-6 response element containing anEts-binding site and a CRE-like site in the junB promoter. Mol. Cell. Biol. 13:3027-3041.

34. Suter, U., G. Texido, and H. Hofstetter. 1989. Expression of human lymphocyte IgE receptor(FcR1I/CD23)identification of theFcR11apromoter and its functional analysis in Blymphocytes.J. Immunol. 143:3087-3092.

35.Yokota,A., H.Kikutani,T.Tanaka, R. Sato, E. L. Barsumian, M. Suemura, and T.Kishimoto. 1988. Two species of human Fc, receptor II(FcRI/CD23): tissue-specificandIL-4-specificregulation of gene expression. Cell. 55:611-618. 36.Xu, M. Z., and J. Stavnezer. 1992. Regulation of transcription of immuno-globulingerm-line y 1 RNA: analysisof the promoter/enhancer. EMBO (Eur. Mol. Biol. Org.) J. 11:145-155.

37. Rothman, P., S. C.Li,B.Gorham, L. Glimcher, F. Alt, and M. Boothby. 1991.Identificationof a conserved lipopolysaccharide-plus-interleukin-4-respon-sive element located at the promoter of germ lineEtranscripts.Mol. Cell. Biol. 11:5551-5561.

38.Glimcher,L.H.,andC. J. Kara. 1992. Sequences and factors: a guide to MHC class-IItranscription.Annu.Rev.Immunol. 10:13-49.

39.Albrecht,B., S.Peiritsch,and M. Woisetschlager. 1994. A bifunctional control element in the human IgE germline promoter involved in repression and IL-4activation. Int. Immunol. 6:1143-1151.

40.Jabara, H.H.,S. M. Fu, R. S. Geha, and D. Vercelli. 1990. CD40 and IgE:synergismbetweenanti-CD40 monoclonal antibody and interleukin 4 in the induction of IgE synthesis by highly purified human B cells. J. Exp. Med.

172:1861-1864.