PCR assay based on DNA coding for 16S rRNA for detection and identification of mycobacteria in clinical samples

0095-1137/95/$04.0010

Copyrightq1995, American Society for Microbiology

PCR Assay Based on DNA Coding for 16S rRNA for Detection

and Identification of Mycobacteria in Clinical Samples

L. F. F. KOX,

_{* J.}

VAN

LEEUWEN,

S. KNIJPER,

H. M. JANSEN,

A. H. J. KOLK

Department of Biomedical Research, Royal Tropical Institute,

_{and Division of}

Pulmonary Diseases, Academic Medical Centre,

Amsterdam, The Netherlands

Received 12 May 1995/Returned for modification 12 July 1995/Accepted 19 September 1995

A PCR and a reverse cross blot hybridization assay were developed for the detection and identification of

mycobacteria in clinical samples. The PCR amplifies a part of the DNA coding for 16S rRNA with a set of

primers that is specific for the genus Mycobacterium and that flanks species-specific sequences within the genes

coding for 16S rRNA. The PCR product is analyzed in a reverse cross blot hybridization assay with probes

specific for M. tuberculosis complex (pTub1), M. avium (pAvi3), M. intracellulare (pInt5 and pInt7), M. kansasii

complex-M. scrofulaceum complex (pKan1), M. xenopi (pXen1), M. fortuitum (pFor1), M. smegmatis (pSme1),

and Mycobacterium spp. (pMyc5a). The PCR assay can detect 10 fg of DNA, the equivalent of two mycobacteria.

The specificities of the probes were tested with 108 mycobacterial strains (33 species) and 31 nonmycobacterial

strains (of 17 genera). The probes pAvi3, pInt5, pInt7, pKan1, pXen1, and pMyc5a were specific. With probes

pTub1, pFor1, and pSme1, slight cross hybridization occurred. However, the mycobacterial strains from which

the cross-hybridizing PCR products were derived belonged to nonpathogenic or nonopportunistic species which

do not occur in clinical samples. The test was used on 31 different clinical specimens obtained from patients

suspected of having mycobacterial disease, including a patient with a double mycobacterial infection. The

samples included sputum, bronchoalveolar lavage, tissue biopsy samples, cerebrospinal fluid, pus, peritoneal

fluid, pleural fluid, and blood. The results of the PCR assay agreed with those of conventional identification

methods or with clinical data, showing that the test can be used for the direct and rapid detection and

identification of mycobacteria in clinical samples.

The human immunodeficiency virus (HIV) epidemic is

hav-ing a profound impact on the tuberculosis problem (2, 5, 10).

Serious diseases caused by mycobacteria other than

Mycobac-terium tuberculosis, mostly those belonging to the M. avium-M.

intracellulare (MAI) complex, are now commonly associated

with severe immunosuppression (21, 35, 58, 59). Opportunistic

mycobacteria commonly associated with HIV are M. kansasii,

M. xenopi, M. fortuitum, and M. scrofulaceum (46, 58).

Addi-tional risk factors for mycobacterial disease other than

tuber-culosis are iatrogenic immunosuppression, preexisting lung

disease, e.g., chronic obstructive pulmonary disease, and a

pre-vious tuberculosis (37).

A correct diagnosis of the mycobacterial disease is important

because the treatment of tuberculosis differs from that for

diseases caused by other mycobacteria, which are often

resis-tant to the drugs used for treating tuberculosis (19, 27).

The methods of identification in current use require

cul-tured mycobacteria. Culture from clinical samples is hampered

by the slow growth of mycobacteria. Inoculation on solid media

requires a mean incubation time of 4 weeks before sufficient

growth is obtained to enable identification to begin. Two

speedier methods for culture are the radiometric method (1,

41, 49) and a biphasic (broth-agar) system (20, 45). By

con-ventional biochemical methods (52, 57), the identification of

the species to which the cultured mycobacterial strain belongs

may require an additional 2 to 4 weeks. More rapid methods

for the identification of cultured mycobacteria are the analysis

of lipid composition (7, 11, 33), the use of species-specific

antibodies (44, 56), and species-specific DNA or RNA probes

(14, 16, 32).

Nucleic acid amplification techniques provide new

possibil-ities for the rapid diagnosis of mycobacterial diseases. Most of

the tests are based on PCR amplification of the M.

tuberculosis-specific repetitive sequence IS6110 (6, 8, 9, 18, 26, 28, 29, 38).

RNA amplification tests with 16S rRNA sequences have also

been used (23, 36, 39, 53). PCR assays based on DNA coding

for 16S rRNA (16S rDNA) sequences have been developed for

the detection and identification of mycobacteria other than M.

tuberculosis (3, 22, 24, 40, 54). These tests, however, have not

been used for the direct detection and identification of

myco-bacteria in clinical samples. Our study is the first in which a 16S

rDNA-based PCR assay was used directly on clinical samples.

We report the development of a 16S rDNA-based PCR and

a reverse cross blot hybridization assay to detect and identify

mycobacteria directly in clinical samples. We present the

re-sults with 31 different clinical specimens obtained from

pa-tients suspected of having mycobacterial disease.

MATERIALS AND METHODS

Bacterial strains.The bacterial strains that are used in this study are listed in

Table 1.

DNA isolation from bacteria.DNA was isolated as previously described (17)

and dissolved in Tris-EDTA (TE) buffer (10 mM Tris-HCl [pH 8.3], 1 mM EDTA) containing ribonuclease at a concentration of 5mg/ml (RNase from bovine pancreas, DNase free; Boehringer, Mannheim, Germany). The DNA concentration was determined by measuring the A260by using the following

conversion factor: an A260of 1 corresponds to a DNA concentration of 50mg/ml.

A part of the DNA solution was diluted to a concentration of 10 ng/ml and then further diluted in TE buffer to provide five samples with a concentration ranging from 1 ng to 100 fg of DNA per ml.

Bacterial lysates.With a loop, a small amount of bacteria (approximately 1

mg; about 108

bacteria) was suspended in a vial containing 0.5 ml of TE buffer and 0.5 ml of glass beads with a diameter of 0.10 to 0.15 mm (Biospec Products,

* Corresponding author. Mailing address: Department of Biomedi-cal Research, Royal TropiBiomedi-cal Institute, Meibergdreef 39, 1105 AZ Amsterdam, The Netherlands. Phone: 5665441. Fax: 31-20-6971841.

3225

on May 15, 2020 by guest

http://jcm.asm.org/

TABLE 1. Bacterial strains used in this study

KIT codea

Sourceb Other designation(s)

and/or source

M. abscessus myc11303 RIVM myc11303 M. africanum 1 RIVM myc5544 M. asiaticum 2 RIVM J26114 M. asiaticum 3 RIVM J26115 M. asiaticum 4 RIVM 3598/68 M. avium 1 RIVM myc3875

M. avium 2 ITG 8063

M. avium 3 AMC myc8945

M. avium 4 AMC myc8946

M. avium 6 AMC myc8455

M. avium 7 AMC myc8895

M. avium 10 AZN 0576; myc3798 M. avium 12 AMC 701551; myc9469 M. avium 22 RIVM Ben Kova M. avium 33 RIVM 4443-1237 M. avium 38 RIVM 32114 Perth M. avium 39 RIVM Manten 157

M. avium 50 RIVM Peter Melnick; ATCC 35770 M. avium 54 RIVM Claude Huntly

M. avium 69 CDI St 18 M. avium 88 RIVM myc13213 M. avium 89 RIVM myc13216 M. avium 90 RIVM myc13227 M. avium 92 RIVM myc400725 M. bovis 2 RIVM ATCC 19210 M. bovis BCG 1 SSI Danish; ATCC 35733 M. bovis BCG 11 AMC Connaught; ATCC 35745 M. chelonae 3 ITG 515

M. chelonae 7 TD A542 M. chelonae myc4358 RIVM myc4358 M. chelonae myc4662 RIVM myc4662 M. flavescens 1 RIVM ATCC 14474 M. flavescens FP3220 SSI FP3220 M. fortuitum 1 RIVM ATCC 6841 M. fortuitum 10 TD A391 M. fortuitum AT39 SSI AT39 M. fortuitum FP841 SSI FP841 M. fortuitum FP851 SSI FP851 M. fortuitum FP2784 SSI FP2784 M. gastri 1 RIVM ATCC 25220

M. gastri 2 ITG 8065

M. gordonae 7 ITG 10712 M. gordonae 17 SZU´ 6965 M. gordonae 18 SZU´ 7586

M. intracellulare 1 ITG 6997; ATCC 15985 M. intracellulare 5 RIVM IWGMT3 M. intracellulare RT224 SSI RT224 M. kansasii 1 RIVM myc1012 M. kansasii 4 SZU´ my32/68 M. kansasii 8 SZU´ my103/72 M. kansasii 11 SZU´ my434/68 M. kansasii 20 SZU´ MK2

M. lufu 1 RIVM 219

M. malmoense 1 ITG 7753 M. malmoense J1072 RIVM J1072 M. malmoense S709 RIVM S709

M. marinum 3 ITG L66

M. microti 1 ITG 1278 M. nonchromogenicum 3 RIVM ATCC 25144 M. nonchromogenicum 4 RIVM ATCC 25145 M. parafortuitum 1 ITG 6999 M. paratuberculosis 4/552 SZU´ 4/552 M. paratuberculosis 6/712 SZU´ 6/712 M. paratuberculosis 7/450 SZU´ 7/450 M. paratuberculosis 92X SZU´ 92x M. peregrinum 1 AvL TB6849

M. phlei 1 ITG 258

Continued

TABLE 1—Continued

KIT codea

Sourceb Other designation(s)

and/or source

M. phlei 4 CDI Weybridge R82 M. phlei 7 CDI Jirgenseb 3 M. phlei 8 CDI Jirgenseb 4 M. phlei 9 CDI Jirgenseb 5 M. scrofulaceum 1 RIVM myc3442 M. scrofulaceum 8 RIVM myc6672 M. scrofulaceum 9 RIVM SCS47/2 M. scrofulaceum 10 RIVM atyp441 M. scrofulaceum 11 RIVM ATCC 19981 M. senegalense FP701 SSI FP701 M. simiae 1 ID-DLO 784; hb2579 M. simiae 2 ID-DLO 785; hb3992 M. simiae 3 ID-DLO 785; 59IX7 M. szulgai SCS74/31 RIVM SCS74/31 M. szulgai myc5055 RIVM myc5055 M. smegmatis 1 RIVM ATCC 14468 M. smegmatis 3 ITG 8070 M. smegmatis 4 RIVM mc2₁₅₅

M. smegmatis 1008 RIVM 1008 M. terrae 2 RIVM SCS74/14 M. thermoresistibile 1 ITG 7001

M. triviale 1 ITG 8067

M. tuberculosis 1 RIVM myc4514 M. tuberculosis 9 AZN 8215 M. tuberculosis 15 RIVM myc7114 M. tuberculosis 72 RIVM ATCC 35801 M. tuberculosis 77c

RIVM myc14967

M. tuberculosis 87 TD 7958 M. tuberculosis 94 TD A1454 M. tuberculosis 98 TD A1929 M. tuberculosis H37Rv RIVM H37Rv

M. ulcerans 1 ITG 932

M. vaccae 3 RIVM ATCC 25950 M. xenopi 2 AZN Clinical isolate

M. xenopi 3 AMC 1623369-120448-714348V

M. xenopi 6 SZU´ 125

M. xenopi 7 SZU´ 132

M. xenopi 8 SZU´ 142

M. xenopi 9 SZU´ 143

M. xenopi 10 SZU´ 189 M. xenopi 13 SZU´ 200 Actinomyces spp. 10.124 VMDC 10.124 Actinomyces israelii 103.62 CBS 103.62 Actinomyces pyogenes 12-67 VMDC 12-67 Actinomyces pyogenes ATCC 19411 VMDC ATCC 19411 Actinomyces suis SZ 7393 VMDC SZ7393 Corynebacterium belfanti 1 AMC Clinical isolate Corynebacterium JK 1 AMC Clinical isolate Corynebacterium renale 3R1015 VMDC 3R1015 Corynebacterium xerosis 1 AMC Clinical isolate Corynebacterium xerosis 2 AMC Clinical isolate Nocardia spp. MS87-26 VMDC MS87-26 Nocardia asteroides myc3039 RIVM myc3039 Nocardia farcinicia 1 LPH 76443 Nocardia farcinicia 2 LPH 30975 Propionibacterium acnes 1 AMC Clinical isolate Rhodococcus equi 7P895 VMDC 7P895 Rhodococcus equi 10P388 VMDC 10P388 Branhamella catarrhalis 2 AMC Clinical isolate Campylobacter jejuni 1 AMC Clinical isolate Escherichia coli 2 UvA MC4100; ATCC 35695 Escherichia coli 4 AMC Clinical isolate Haemophilus influenzae 1 AMC Clinical isolate Klebsiella pneumoniae 1 AMC Clinical isolate Lactobacillus spp. 1 AMC Clinical isolate Legionella pneumophila 1 AMC Clinical isolate Pseudomonas aeruginosa 1 AMC Clinical isolate

Continued on following page

on May 15, 2020 by guest

http://jcm.asm.org/

Bartlesville, Okla.). The suspension was incubated for 15 min at 1008C to kill the bacteria. The cells were lysed by shaking the suspensions in a mechanical dis-ruptor (MiniBeadBeater model 3110; Biospec Products) for 1 min at maximum speed. After the glass beads had settled, a part of the bacterial lysate was diluted 100 times in TE buffer. This dilution contained about 10 ng of DNA per ml. Ten microliters of this solution was used for the PCR.

Clinical samples.Clinical samples were obtained from various hospitals in The

Netherlands. Microscopic examinations and cultures of the clinical samples were performed at the microbiology laboratories of the hospitals where the patients were diagnosed. The PCR was performed at the Royal Tropical Institute.

Microscopy.All clinical samples were concentrated and examined under the

microscope after Ziehl-Neelsen staining (48).

Decontamination of sputum for culture.Sputum samples were

decontami-nated, depending on the preference of the laboratory, by the NaOH Petroff method (15), by the sodium laurylsulfate method (15), or with NaOH-sodium citrate-N-acetyl-L-cysteine (30). In all these cases, samples were concentrated by centrifugation after decontamination.

Routine culture.Samples were cultured on two solid media, Lo

¨wenstein-Jensen and Coletsos or Ogawa. The samples from extrapulmonary sites were cultured in addition on Middlebrook 7H9 broth (Difco Laboratories, Detroit, Mich.) and/or Septi-Chek AFB (Becton Dickinson Microbiology Systems, Cock-eysville, Md.). Cultured mycobacteria were identified by standard biochemical methods (52, 57).

DNA isolation from clinical samples.The clinical samples were sent at

ambi-ent temperature to the Royal Tropical Institute, where the DNA isolation pro-cedures were performed as previously described (29). Samples that could not be tested on the same day that they arrived were treated up to and including the lysis buffer step or the proteinase K step.

Oligonucleotides.The oligonucleotides (Isogen Biosciences, Amsterdam, The

Netherlands) that were used as primers in the PCR and as probes for hybrid-ization with 16S rDNA sequences are listed in Table 2. The forward primer pMyc14 was biotin labeled at the 59end of the DNA via a six-carbon-spacer arm (pMyc14bio).

PCR.The composition of the PCR mixture for the amplification of 16S rDNA sequences was 10 mM Tris-HCl (pH 8.3), 50 mM NaCl, 3.0 mM MgCl2, 0.01%

(wt/vol) gelatin, 0.2 mM (each) deoxynucleoside triphosphates (dATP, dGTP, dCTP, and dUTP), 0.2mM (each) primers pMyc14bio and pMyc7, 1 U of Taq DNA polymerase (Perkin-Elmer Cetus, Norwalk, Conn.), and 0.2 U of

uracil-N-glycosylase (UNG; GIBCO BRL, Gaithersburg, Md.) per 50-ml reaction mix-ture volume. For the amplification of IS6110 sequences with the primers INS1 and INS2 (26) we used a PCR mixture similar to that described previously (29). The PCR mixture was aliquoted to a final volume of 35ml per reaction vial and stored at2208C. When a test was performed, the reaction vials were removed from the freezer and 50ml of mineral oil (Sigma, St. Louis, Mo.) was added before the 10-ml sample was placed under the oil. Each clinical sample was tested in duplicate in the PCR. To test for inhibitors, one part of the sample was spiked with DNA (50 fg in the IS6110-based PCR and 200 fg in the 16S rDNA-based PCR) of a M. smegmatis strain containing a modified IS6110 sequence (25); the other part was not spiked. PCR was performed in a water bath thermocycler (Bio-med 60 processor; Bio-med, Theres, Germany) or a heating block thermo-cycler (Gene ATAQ controller; Pharmacia LKB, Uppsala, Sweden). Prior to amplification the PCR mixtures were incubated for 10 min at 408C to allow UNG to excise uracil from any contaminating dU-containing PCR product. A PCR cycle included 1.5 min of denaturation at 948C, 2 min of annealing at 658C, and 3 min of extension at 728C. At these high cycling temperatures, the UNG is inactivated and any possible contaminants are broken into small fragments. A total of 40 PCR cycles were performed. After the last PCR cycle, the vials were maintained at 728C until they were removed from the PCR machine to avoid the degradation of newly synthesized dU-containing PCR products by residual or regained activity of UNG. Reaction mixtures were stored at2208C.

Agarose gel electrophoresis.Electrophoresis of PCR products (16ml) was

performed on 2% agarose gels stained with ethidium bromide. PCR products were visualized by UV fluorescence. The results were recorded by Bio-print photodocumentation (Vilber-Lourmat, Marne-La-Valle´e, France).

Tailing of oligonucleotide probes with dTTP.The tailing reactions were

per-formed with 200 pmol of the oligonucleotide probe in a solution containing 25 mM Tris-HCl (pH 6.6), 200 mM potassium cacodylate, 0.025% (wt/vol) bovine serum albumin, 5 mM CoCl2, 0.5 mM dTTP, and 25 U of terminal transferase

(Boehringer) per 40-ml reaction mixture volume. The reaction mixtures were incubated at 378C. After 2 h of incubation the reactions were stopped by adding 4ml of a 0.2-mM EDTA solution. Tailing the oligonucleotide probes is necessary for the efficient capture of the PCR products in the reverse cross blot hybrid-ization assay.

Reverse cross blot hybridization assay.The reverse cross blot hybridization

assays were performed in a cross blotter (Accutran-Cross ACC 100/0; Schleicher & Schuell, Dassel, Germany) in which different molds can be used. The cross blot

TABLE 2. Nucleotide sequences of oligonucleotides (primers and probes) for amplification and hybridization of 16S rDNA sequences

Oligonucleotide Relevant characteristic(s) Strand type

and positiona Nucleotide sequence (59to 39)

pMyc14bio Forward primer, 59biotinylated .49–68 GRGRTACTCGAGTGGCGAACb

pMyc7 Reverse primer ,261–244 GGCCGGCTACCCGTCGTC

pTub1 M. tuberculosis complexc_{probe ,168–148 ACCACAAGACATGCATCCCG}

pAvi3 M. avium-M. paratuberculosisd_{probe ,168–148 ACCAGAAGACATGCGTCTTG}

pInt5 M. intracellulare probe Ie _{,169–147 CACCTAAAGACATGCGCCTAA}

pInt7 M. intracellulare probe IIe _{,169–147 CACCAAAAGACATGCGTCTAA}

pKan1 M. kansasii complexf_{-M. scrofulaceum complex}g_{probe ,168–148 ACCACAAGGCATGCGCCAAG}

pXen1 M. xenopi probe ,168–148 ACCACCCCACATGCGCAGAA

pFor M. fortuitum-M. senegalenseh_{probe ,168–148 ACCACACACCATGAAGCGCG}

pSme1 M. smegmatis probe ,158–140 CATGCGACCAGCAGGGTGT

pMyc5a Mycobacterium probe _,201–184 GGGCCCATCCCACACCGC

a_.

, coding strand;,, noncoding strand. Numbering is according to the alignment of Rogall et al. (42).

b

R, A or G.

c

The M. tuberculosis complex consists of M. tuberculosis, M. africanum, M. bovis, M. bovis BCG, and M. microti (13).

d

M. paratuberculosis is considered to be a subspecies of M. avium (51). e

M. intracellulare is characterized by different 16S rDNA sequences (4), most of which hybridize with probe pInt5. f

The M. kansasii complex consists of M. kansasii plus M. gastri (13).

g

The M. scrofulaceum complex consists of M. scrofulaceum and M. simiae (13).

h

M. senegalense is pathogenic for animals and is related to M. fortuitum (47). TABLE 1—Continued

KIT codea

Sourceb Other designation(s)

and/or source

Salmonella typhimurium 1 AMC Clinical isolate Shigella flexneri 1 AMC Clinical isolate Staphylococcus aureus 1 AMC Clinical isolate Streptococcus pneumoniae 1 AMC Clinical isolate Streptococcus pyogenes 1 AMC Clinical isolate

a_{Species were determined by biochemical means by the supplier of the strain.}

KIT, Royal Tropical Institute, Amsterdam.

b_{AMC, Academic Medical Centre, Amsterdam, The Netherlands; AvL,}

toni van Leeuwenhoek Hospital, Amsterdam, The Netherlands; AZN, St. An-tonius Hospital Nieuwegein, Utrecht, The Netherlands; CBS, Central Bureau for Fungal Cultures, Baarn, The Netherlands; CDI, Central Veterinary Institute, Lelystad, The Netherlands; ITG, Institute for Tropical Medicine, Antwerp, Bel-gium; KIT, Royal Tropical Institute, Amsterdam, The Netherlands; LVF, Lab-oratory for Public Health, Leeuwarden, The Netherlands; RIVM, National In-stitute of Public Health and Environmental Protection, Bilthoven, The Netherlands; SSI, Statens Serum Institute, Copenhagen, Denmark; SZU´ , Na-tional Institute for Public Health, Prague, Czech Republic; TD, Tuberculosis Division, Ministry of Public Health, Bangkok, Thailand; UvA, University of Amsterdam, Amsterdam, The Netherlands; VMDC, Veterinary Microbiological Diagnostic Centre, Utrecht, The Netherlands.

c_{M. tuberculosis 77 is a strain lacking IS6110.}

on May 15, 2020 by guest

http://jcm.asm.org/

system is illustrated in Fig. 1. The reverse cross blot hybridization assay was performed as follows.

(i) Preparation of membranes.The rubber mat of the blot assembly was

covered with Parafilm (Parafilm ‘‘M’’ laboratory film; American National Can, Greenwich, Conn.), two layers of blotting paper (GB 002; Schleicher & Schuell), a piece (6 by 13 cm) of reinforced nitrocellulose membrane (Optitran BA-S 83; Schleicher & Schuell), and a mold (7 by 14 cm) with 34 horizontal slots num-bered 0 to 33 (50 by 2 mm) on top of the membrane. To each slot of the mold, 25 pmol of a dTTP-tailed oligonucleotide probe in 500ml of 103SSC (13SSC is 0.15 M NaCl and 0.015 M sodium citrate [pH 7.0]) was added. The cross blotter was placed on a rotary shaker (TPM-2; Sarstedt, Nu¨mbrecht, Germany) at 100 rpm for 16 h. The slots of the mold in the cross blotter were washed with 500ml of 103SSC, and then the membrane was washed separately with 103SSC and incubated on the rotary shaker. The probes were fixed to the membrane by UV light of 312 nm until 1 J/cm2

was reached (Fluo-link TFL20M; Vilber-Lourmat). Baking in an oven at 1208C for 15 min gives the same result.

(ii) Hybridization assay.The membrane was put in the cross blotter on a layer

of Parafilm on the rubber mat, and a different mold with four blocks of 14 vertical slots marked A to N (2 by 30 mm) was placed on top of it. The slots of the membrane were prehybridized in 200ml of hybridization solution containing 53

SSC, 1% (wt/vol) blocking agent (Boehringer), 0.1% (wt/vol) N-laurylsarcosine, and 0.02% (wt/vol) sodium dodecyl sulfate (SDS) at room temperature on the rotary shaker. After at least 5 min of prehybridization, the hybridization solution was discarded. Samples of 15ml of PCR product were denatured by boiling for 5 min and subsequent cooling on ice. After the addition of 200ml of ice-cold hybridization solution, the samples were added to the slots of the cross blotter and incubated at 508C for 1 h on the rotary shaker. The cross blotter was emptied by flicking, and the slots were incubated with 200ml of 0.1% (wt/vol) SDS in 23

SSC at 508C for 5 min on the rotary shaker. The hybridized PCR products on the membrane were detected by incubation with streptavidin-alkaline phosphatase and a color substrate (4-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolylphosphate) according to the instructions of the manufacturer (Boehr-inger).

RESULTS

Sensitivity and specificity of the PCR after agarose gel

elec-trophoresis.

The sensitivity of the PCR with primers pMyc14

bio and pMyc7 (Table 2) was tested in duplicate with 100, 10,

and 1 pg and 100, 10, and 1 fg of DNA from M. tuberculosis 1,

M. avium 2, M. intracellulare 1, M. kansasii 1, M. xenopi 2, M.

fortuitum 1, and M. smegmatis 1008 (Table 1). The PCR

prod-ucts were electrophoresed on 2% agarose gels stained with

ethidium bromide. Figure 2 shows that with M. tuberculosis

DNA a 208-bp fragment is amplified and that the detection

limit is 100 fg of DNA, which amounts to 20 mycobacteria. The

detection limits were the same for the other species of

myco-bacteria tested (results not shown).

DNA from lysates of the other 101 mycobacterial strains (33

species) listed in Table 1 could be amplified in the PCR. Of the

31 nonmycobacterial strains (of 17 genera) tested, only DNA

from lysates from some species belonging to genera closely

related to the genus Mycobacterium, namely, Corynebacterium

renale, Corynebacterium xerosis, Corynebacterium JK, Nocardia

asteroides, Nocardia farcinicia, and Rhodococcus equi, could be

amplified as tested by agarose gel electrophoresis (results not

shown). These products are formed because of the low number

of mismatches between the primers pMyc7 and pMyc14bio and

the 16S rDNA sequences of these bacteria (up to two

mis-matches per primer).

Sensitivity and specificity of the PCR after the reverse cross

blot hybridization assay.

Membranes were spotted with the

dTTP-tailed probes: pTub1, pAvi3, pInt5, pKan1, pXen1,

pFor1, pSme1, and the Mycobacterium-specific probe pMyc5a

(Table 2). The sensitivity of the reverse cross blot hybridization

assay with biotinylated 16S rDNA PCR fragments was tested

with 15

m

l of the same PCR products used for agarose gel

electrophoresis. Figure 3 shows that for M. tuberculosis DNA

with the probe pTub1 and the Mycobacterium-specific probe

pMyc5a, 10 fg of DNA, the DNA equivalent of two

mycobac-teria, can be detected. The negative result with 1 fg of DNA is

not shown. For the other six mycobacterial species tested, the

detection limits of the hybridization assays with the

corre-sponding species-specific probe and the genus-specific probe

pMyc5a were the same. When we used the PCR product of 100

pg of mycobacterial DNA, no cross hybridization was found.

The PCR products from lysates of N. asteroides, C. xerosis, and

C. JK (each containing about 100 pg of DNA), although giving

a positive result after agarose gel electrophoresis, showed no

hybridization with the species- and genus-specific probes

men-tioned above.

Tables 3 and 4 show the overall results of the hybridization

of the probes with PCR products from all the strains tested.

Mismatches between the species-specific probes and the

cor-responding regions of other mycobacterial species are detailed

in Table 5. All PCR products from the 108 mycobacterial

FIG. 1. Diagram of cross blot hybridization apparatus.

FIG. 2. Determination of the sensitivity of PCR after agarose gel electro-phoresis. Lane 1, 800 ng of HaeIII-digested PhiX174 DNA (in replicative form) as a molecular size marker; lanes 2 to 6, PCR products from 100, 10, and 1 pg and 100 and 10 fg of M. tuberculosis DNA, respectively.

on May 15, 2020 by guest

http://jcm.asm.org/

strains (33 species) hybridized with the Mycobacterium-specific

probe pMyc5a, while none of the PCR products from the 31

nonmycobacterial strains (17 genera) hybridized with either

the Mycobacterium-specific or the species-specific probes. Even

the PCR products from reactions with C. renale, N. farcinicia,

and R. equi, which, like those of N. asteroides, C. xerosis, and C.

JK, give a clearly visible band after gel electrophoresis, did not

hybridize with the genus-specific probe pMyc5a. The PCR

products of all 13 M. tuberculosis complex strains hybridized

with the species-specific probe pTub1, including M. tuberculosis

77, which lacks the IS6110 sequence. Cross hybridization was

observed with the PCR product from the M. asiaticum strain

(one mismatch), and a weak signal was observed with the PCR

product from M. terrae (three mismatches). The PCR products

from all 22 MAI complex and 4 M. paratuberculosis strains

hybridized with one of the three MAI complex probes (pAvi3,

pInt5, and pInt7). Table 4 shows the results with the MAI

probes in more detail. The PCR products from the three

strains that were identified as M. intracellulare by biochemical

methods hybridized with probe pInt5. All PCR products from

the M. paratuberculosis strains hybridized with probe pAvi3,

which is consistent with the fact that M. paratuberculosis is now

considered to be a subspecies of M. avium (51). Of the PCR

products from the 19 strains that were identified as M. avium

by biochemical means, 13 hybridized with probe pAvi3, 5

hy-bridized with probe pInt5, and 1 hyhy-bridized with probe pInt7

(and weakly hybridized with probes pAvi3 and pInt5). Both

serotyping and hybridization suggest that these last six strains

are M. intracellulare. The PCR products from M. kansasii, M.

gastri, M. scrofulaceum, and M. simiae were the only ones to

hybridize with probe pKan1. The PCR products of all M.

for-tuitum strains and the M. senegalense strain hybridized with

probe pFor1. There was cross hybridization with the PCR

products from M. peregrinum (two mismatches), formerly

named M. fortuitum subsp. peregrinum (31), with probe pFor1.

Note that the PCR products of the M. chelonae strains and the

M. abscessus strain, belonging to the M. fortuitum complex (13),

did not hybridize with probe pFor1. In addition to this, the

PCR products from M. nonchromogenicum strains hybridized

with pFor1 (three mismatches). No other PCR products

bridized with probe pFor1. The only PCR products that

hy-bridized with probe pXen1 were those of the M. xenopi strains.

The hybridization of PCR products with probe pSme1 was

positive for the PCR products of the M. smegmatis strains but

also for the PCR products of M. thermoresistibile (one

mis-match) and M. flavescens (four mismatches). No other cross

hybridization was observed.

Results of the 16S rDNA-based PCR assay compared with

those of the IS6110-based PCR assay and conventional

meth-ods.

We tested in our 16S rDNA-based PCR assay 18 clinical

samples which were positive in the IS6110-based PCR assay for

the detection of M. tuberculosis (26, 29). Table 6 shows that 17

of the 18 clinical samples had a positive result with the M.

tuberculosis probe pTub1 in the 16S rDNA-based PCR assay.

Biopsy sample 6 was positive in the IS6110-based PCR assay,

indicating that M. tuberculosis was present in the clinical

sam-ple. However, only M. avium was cultured. In the 16S

rDNA-based PCR assay, the PCR product of biopsy sample 6

hybrid-ized with both probes pTub1 and pAvi3. This indicated that

both M. tuberculosis and M. avium were present. The patient

had a double infection. Sample 7, a bronchoalveolar lavage,

was positive by microscopy but negative in culture. The fact

that these mycobacteria could not be cultured indicates that

FIG. 3. Determination of the sensitivity and specificity of PCR by the reverse cross blot hybridization assay. Lanes 1 to 4, PCR product from 100 pg, 1 pg, 100 fg, and 10 fg of M. tuberculosis DNA, respectively; lane 5, PCR product from 100 pg of M. avium DNA; lane 6, 100 pg of M. intracellulare DNA; lane 7, PCR product from 100 pg of M. kansasii DNA; lane 8, PCR product from 100 pg of

M. xenopi DNA; lane 9, PCR product from 100 pg of M. fortuitum DNA; lane 10,

PCR product from 100 pg of M. smegmatis DNA; lane 11, PCR product from N.

asteroides lysate; lane 12, PCR product from C. xerosis lysate; lane 13, PCR

product from C. JK lysate; lane 14, PCR product from water. Details of the probes are given in Table 2.

TABLE 3. Results of hybridization of mycobacterial and nonmycobacterial 16S rDNA PCR products with

specific oligonucleotide probes

Species (n)a Result of hybridization with probe: b

pTub1 pMAIc_{pKan1 pXen1 pFor1 pSme1 pMyc5a}

M. tuberculosis (8) 1 2 2 2 2 2 1

M. africanum (1) 1 2 2 2 2 2 1

M. bovis (3) 1 2 2 2 2 2 1

M. microti (1) 1 2 2 2 2 2 1

M. asiaticum (3) 1/2 2 2 2 2 2 1

M. terrae (1) 1/2 2 2 2 2 2 1

MAI complexd

(22) 2 1 2 2 2 2 1

M. paratuberculosis (4) 2 1 2 2 2 2 1

M. kansasii (5) 2 2 1 2 2 2 1

M. gastri (2) 2 2 1 2 2 2 1

M. scrofulaceum (5) 2 2 1 2 2 2 1

M. simiae (3) 2 2 1 2 2 2 1

M. xenopi (8) 2 2 2 1 2 2 1

M. fortuitum (6) 2 2 2 2 1 2 1

M. senegalense (1) 2 2 2 2 1 2 1

M. peregrinum (1) 2 2 2 2 1/2 2 1

M. nonchromogenicum (2) 2 2 2 2 1/2 2 1

M. smegmatis (4) 2 2 2 2 2 1 1

M. thermoresistibile (1) 2 2 2 2 2 1 1

M. flavescens (2) 2 2 2 2 2 1/2 1

M. chelonae (4) 2 2 2 2 2 2 1

M. abscessus (1) 2 2 2 2 2 2 1

M. gordonae (3) 2 2 2 2 2 2 1

M. lufu (1) 2 2 2 2 2 2 1

M. malmoense (3) 2 2 2 2 2 2 1

M. marinum (1) 2 2 2 2 2 2 1

M. parafortuitum (1) 2 2 2 2 2 2 1

M. phlei (5) 2 2 2 2 2 2 1

M. szulgai (2) 2 2 2 2 2 2 1

M. triviale (1) 2 2 2 2 2 2 1

M. ulcerans (1) 2 2 2 2 2 2 1

M. vaccae (1) 2 2 2 2 2 2 1

Non-Mycobacteriume_{(31) 2 2 2 2 2 2 2} a

n, number of strains. b

Details of the probes are given in Table 2.1, positive;1/2, weakly positive;

2, negative.

c

pMAI probes used were pAvi3, pInt5, or pInt7.

d

Results with MAI probes (pAvi3, pInt5, and pInt7) are given in more detail in Table 4.

e

The non-Mycobacterium species are represented by 17 genera.

on May 15, 2020 by guest

http://jcm.asm.org/

they were not viable. All seven microscopy-positive samples

and 10 of 11 microscopy-negative samples were positive with

probe pTub1 in the 16S rDNA-based PCR assay.

Results of the 16S rDNA-based PCR assay compared with

results of conventional methods.

The 16S rDNA PCR assay

was performed on 13 clinical samples from 8 patients

sus-pected of having mycobacterial infections other than

tubercu-losis (Table 7). At the time that the samples were tested, the

results of cultures were not known. Samples 19 and 20 were

sputum samples from a patient with chronic obstructive

pul-monary disease. Both samples had a positive result with probe

pAvi3, and M. avium was cultured from both. Samples 21 and

22 (bronchoalveolar lavages) and 3 (sputum) were from

an-other patient with chronic obstructive pulmonary disease who

had had an M. avium infection one year previously, proven by

culture and biochemical identification. The 16S rDNA-based

PCR assay gave a positive result with probe pAvi3. M. avium

was cultured from all three samples. Sample 24 was a blood

sample giving a positive result with probe pAvi3. The patient

was an 83-year-old woman with pulmonary infiltrates who was

diagnosed with Wegener’s disease. She was treated with

ste-roids and azathioprine. The blood was not cultured for

myco-bacteria. The death of the patient precluded confirmation of

the PCR result by testing another blood sample. Sample 25

(sputum) from another patient was positive with probe pInt5.

The cultured mycobacterium was identified as belonging to the

MAI complex. Samples 26 (sputum), 27 (bronchoalveolar

la-vage), and 28 (sputum), from three separate patients, were

positive with probe pKan1. These results were confirmed

be-cause M. kansasii was cultured. Samples 29, 30 (peritoneal

fluids), and 31 (endometrium biopsy), which were obtained

from one patient, were all positive with probe pFor1,

suggest-ing an infection with M. fortuitum. No mycobacteria were

cul-tured from these samples. The patient was first treated with

antituberculous drugs (rifampin, isoniazid, and pyrazinamide)

but without effect. She improved when other antimycobacterial

TABLE 4. Results of hybridization of the MAI complex and M. paratuberculosis 16S rDNA PCR products with MAI

complex-specific oligonucleotide probes

Serotypea _{KIT code}b

Result of hybridization with probe:c

pAvi3 pInt5 pInt7

2 M. avium 1 1 2 2

2 M. avium 2 1 2 2

2 M. avium 69 1 2 2

2/3 M. avium 3 1 2 2

3 M. avium 22 1 2 2

4 M. avium 4 1 2 2

4 M. avium 6 1 2 2

4 M. avium 7 _{1 2 2}

5 M. avium 33 1 2 2

7 M. avium 38 _{2 1 2}

7 M. avium 39 2 1 2

8 M. avium 12 _{1 2 2}

16 M. avium 10 2 1 2

16 M. intracellulare 1 _{2 1 2}

18 M. avium 50 1/2 1/2 1

19 M. avium 54 2 1 2

ND M. avium 88 1 2 2

ND M. avium 89 1 2 2

ND M. avium 90 1 2 2

ND M. avium 92 2 1 2

ND M. intracellulare 5 2 1 2

ND M. intracellulare RT244 2 1 2 M. paratuberculosis 4/552 1 2 2 M. paratuberculosis 6/712 1 2 2 M. paratuberculosis 7/450 _{1 2 2} M. paratuberculosis 92X 1 2 2 a_{Serotypes 1 to 6, 8 to 11, and 21 are M. avium. Serotypes 7, 12 to 20, and 25}

are M. intracellulare. It is unclear to what species serotypes 22 to 24 and 26 to 28 belong (43). ND, not determined.

b_{Species were determined by biochemical means by the supplier of the strains.}

KIT, Royal Tropical Institute, Amsterdam.

c_{Details of the probes are given in Table 2.1, positive;1/2, weakly positive;}

2, negative.

TABLE 5. Mismatches between species-specific probes and the corresponding regions in the 16S rDNA of other mycobacterial species

Target sequencea No. of mismatches with probe: b

pTub1 pAvi3 pInt5 pInt7 pKan1 pXen1 pFor1 pSme1

M. tuberculosis complex 0 4 7 5 5 9 6 10

M. asiaticum 1 5 8 6 6 9 6 10

M. terrae 3 7 8 6 7 8 6 11

M. avium-M. paratuberculosis 4 0 5 3 6 9 9 10

M. intracellulare Ic _{7 5 0 2 5 7 11 10}

M. intracellulare IIc _{5 3 2 0 5 6 10 10}

M. kansasii complex-M. scrofulaceum complex 3 5 5 5 0 7 8 9

M. xenopi 9 9 7 6 7 0 9 10

M. fortuitum-M. senegalense 6 9 11 10 8 9 0 12

M. peregrinum 8 11 13 12 10 10 2 13

M. chelonae-M. abscessus 9 10 13 12 10 9 3 13

M. nonchromogenicum 6 7 10 8 6 9 3 11

M. smegmatis 8 10 10 10 8 12 10 0

M. thermoresistibile 8 9 9 7 8 12 10 1

M. flavescens 10 11 10 10 9 11 11 4

M. triviale 7 6 9 7 5 8 5 9

M. gordonae 4 4 8 6 6 10 8 11

M. malmoense-M. szulgai 5 5 5 6 3 9 8 10

M. marinum-M. ulcerans 2 6 9 6 7 7 6 11

M. phlei 7 10 10 10 8 11 10 2

M. vaccae 8 11 12 12 10 12 8 4

a

Sequence data were retrieved from GenBank.

b

Details of the probes are given in Table 2.

c

M. intracellulare is characterized by different 16S rDNA sequences (4).

on May 15, 2020 by guest

http://jcm.asm.org/

drugs (pyrazinamide, ethambutol, ciprofloxacin, and

clarithro-mycin) were used.

DISCUSSION

We developed a PCR and a hybridization assay for the rapid

detection and identification of mycobacteria in clinical

sam-ples. Two oligonucleotides based on mycobacterial 16S rDNA

sequences were used as primers for the PCR. The primers span

a region of the mycobacterial 16S rDNA that is specific at the

species level. The species to which the mycobacterium belongs

is identified by hybridization of the PCR product with

species-specific probes and a Mycobacterium-species-specific probe in a reverse

cross blot hybridization assay. After hybridization of the PCR

product with the Mycobacterium-specific probe pMyc5a, the

DNA equivalent of two mycobacteria could be detected and

the organism was confirmed to belong to the genus

Mycobac-terium.

We chose hybridization analysis of the 16S rDNA PCR

products because it is technically simple. When a cross blot

system is used, one PCR product can be hybridized with

dif-ferent probes simultaneously. Our reverse cross blot

hybrid-ization assay is as simple as our previously described dot blot

hybridization assay (26, 29). The PCR products can also be

analyzed by sequencing (22, 24), but this is not a technique that

is suitable for a routine laboratory. Analysis of the PCR

prod-ucts by restriction enzyme analysis (22, 40, 54) is technically

simpler than sequencing, but analysis of the data is laborious.

Furthermore, when sequencing or restriction enzyme analysis

is performed on 16S rDNA PCR products from a culture or a

clinical sample containing more than one species of

mycobac-teria, it may be difficult, if not impossible, to identify them.

We selected eight species-specific probes for the

identifica-tion of the most important pathogenic and opportunistic

my-cobacteria (Table 2). The specificities of the probes were

tested with 108 mycobacterial strains (33 species) and 31

non-mycobacterial strains (17 genera). Our testing showed no cross

hybridization with the probes pAvi3, pInt5, pInt7, pKan1, and

pXen1. There was some slight cross hybridization of PCR

products from a number of mycobacterial strains with the

probes pTub1, pFor1, and pSme1. This slight cross

hybridi-zation plays no role when testing clinical samples, since the

mycobacterial strains from which the cross-hybridizing PCR

products were derived never belonged to pathogenic or

oppor-tunistic species. For example, the PCR products from M. terrae

and M. asiaticum cross hybridized slightly with probe pTub1. It

has been reported that there are some M. terrae strains that

give positive reactions with a commercially available M.

tuber-culosis complex probe (12). Cross hybridization of M. asiaticum

16S rDNA PCR products with a M. tuberculosis

complex-spe-cific probe has also been reported by Mabilat and coworkers,

who developed an automated hybridization assay for the

iden-tification of M. tuberculosis complex isolates (34). Cross

hybrid-ization can be explained by a small number of mismatches

between species-specific probes and the corresponding regions

in the 16S rRNA of other mycobacterial species (Table 5). In

addition, the position of the mismatches may also influence the

result. For example, M. terrae PCR products that have three

mismatches with probe pTub1 (at positions 7, 8, and 20 from

the 5

9

site of the probe) give slight cross hybridization with

TABLE 6. Results of samples positive by the IS6110-based PCR assay compared with those tested by the 16S rDNA-based

PCR assay, microscopy, and culture

Code Sample typea

Patient

16S rDNA PCR assay probeb

Micros-copy Culture

1 BAL A pTub1 Positive M. tuberculosis

2 Sputum B pTub1 Positive M. tuberculosis

3 Peritoneal fluid C pTub1 Positive M. tuberculosis

4 Sputum D pTub1 Positive M. tuberculosis

5 Sputum E pTub1 Positive M. tuberculosis

6 Lung biopsy F pTub11

pAvi3

Positive M. avium

7 BAL G pTub1 Positive Negative

8 CSF H pTub1 Negative M. tuberculosis

9 Pus I pTub1 Negative M. tuberculosis

10 Pleural fluid J pTub1 Negative M. tuberculosis

11 Sputum K pTub1 Negative Negative

12 Lung biopsy L pTub1 Negative Negative

13 CSF M pTub1 Negative Negative

14 Pleura biopsy N pTub1 Negative Negative

15 CSF O pTub1 Negative Negative

16 CSF O pTub1 Negative Negative

17 Lung biopsy P pTub1 Negative Not done

18 Pus Q Negative Negative Negative

a

BAL, bronchoalveolar lavage; CSF, cerebrospinal fluid.

b

The probes pTub1 and pAvi3 are described in Table 2.

TABLE 7. Results of the 16S rDNA-based PCR assay compared with those of microscopy and culture of samples from patients suspected of having mycobacterial disease other than tuberculosis

Code Sample typea _Patient 16S rDNA PCR

assay probeb Microscopy Culture Other diseasec

19 Sputum R pAvi3 Positive M. avium COPD

20 Sputum R pAvi3 Positive M. avium COPD

21 BAL S pAvi3 Positive M. avium COPD

22 BAL S pAvi3 Positive M. avium COPD

23 Sputum S pAvi3 Positive M. avium COPD

24 Blood T pAvi3 Not done Not done Wegener’s disease

25 Sputum U pInt5 Positive MAI complex None

26 Sputum V pKan1 Positive M. kansasii None

27 BAL W pKan1 Positive M. kansasii AIDS

28 Sputum X pKan1 Positive M. kansasii None

29 Peritoneal fluid Y pFor1 Negative Negative None

30 Peritoneal fluid Y pFor1 Negative Negative None

31 Endometrium biopsy Y pFor1 Negative Negative None

a

BAL, bronchoalveolar lavage.

b

Details of the probes are given in Table 2.

c

COPD, chronic obstructive pulmonary disease.

on May 15, 2020 by guest

http://jcm.asm.org/

probe pTub1, while M. marinum PCR products that have only

two mismatches with probe pTub1 (at positions 7 and 14 from

the 5

9

site of the probe) do not cross hybridize with this probe.

This suggests that the maximum length of matching

nucleo-tides is related to the extent of cross hybridization. For M.

marinum PCR products and probe pTub1 this is only 7

nucle-otides, and for M. terrae PCR products and probe pTub1 this is

11 nucleotides. All cross-hybridizing PCR products from other

species have maximum lengths of at least 10 matching

nucle-otides (results not shown).

It may happen that a PCR product hybridizes with the

Mycobacterium-specific probe but not with one of the

species-specific probes. In such a case, the nucleotide sequence of the

PCR product can be determined for further characterization of

the mycobacterium. Alternatively, we suggest performing a

second reverse hybridization assay with another panel of

spe-cific probes. For this purpose, we are extending the test with

probes for M. chelonae, M. abscessus, M. gordonae, M.

gena-vense, and M. leprae.

PCR assays for the identification of mycobacteria based on

16S rDNA sequences have also been described by others (3, 22,

24, 40, 54). Our study is the first in which a 16S rDNA-based

PCR assay was used directly on a variety of clinical samples.

When we tested 18 clinical samples that were positive by the

IS6110-based PCR, 17 samples were positive with probe pTub1.

In one patient we detected a double infection with M.

tuber-culosis complex and M. avium. The one sample that was

neg-ative in the 16S rDNA-based PCR assay gave a weak positive

result in the IS6110-based PCR assay. There are multiple

cop-ies of the target for this assay in the M. tuberculosis genome and

only one target for the 16S rDNA, explaining the discrepancy

in the results with this sample. An advantage of the 16S

rDNA-based PCR assay over the IS6110-rDNA-based PCR is that the

ex-ceptional strains without IS6110 (50, 55) can be easily detected

as a strain of the M. tuberculosis complex. For optimal

sensi-tivity for the detection and identification of M. tuberculosis

complex and other mycobacteria, a combination of both PCRs

(a multiplex PCR) is favored.

When the test was applied to 13 clinical samples from eight

patients suspected of having mycobacterial disease other than

tuberculosis, results with the 16S rDNA-based PCR assay

cor-responded to results obtained by the biochemical identification

of mycobacteria in all six patients from whom samples could be

cultured. For the other two patients, the results of the 16S

rDNA-based PCR were in agreement with clinical findings.

A great advantage of the PCR-based method is that it can be

performed directly with clinical samples, unlike traditional

typ-ing, for which a cultured mycobacterium strain is needed.

Re-sults with the 16S rDNA-based PCR assay can be obtained

within 72 h of receipt of the clinical sample. Even when

per-formed on cultured mycobacteria, the 16S rDNA-based PCR

assay allows a more rapid and more accurate identification of

mycobacteria than biochemical identification methods, which

can take 2 to 4 weeks. In this study, we demonstrated that our

16S rDNA PCR assay is a very sensitive tool for the direct and

rapid detection and identification of mycobacteria in clinical

samples.

ACKNOWLEDGMENTS

L.F.F.K. was supported by a grant from the Amsterdam Society and Research Fund for Prevention and Cure of Tuberculosis. This study was supported by the commission of the European Communities Di-rectorate for Science Technology and Development (project number TS3-CT91-0036).

We thank E. M. Rankin for a critical review of the manuscript.

REFERENCES

1. Anargyros, P., D. S. J. Astill, and I. S. L. Lim. 1990. Comparison of improved BACTEC and Lo¨wenstein-Jensen media for culture of mycobacteria from clinical specimens. J. Clin. Microbiol. 28:1288–1291.

2. Bloom, B. R., and C. J. L. Murray. 1992. Tuberculosis: commentary on a re-emergent killer. Science 257:1055–1064.

3. Bo¨ddinghaus, B., T. Rogall, T. Flohr, H. Blo¨cker, and E. C. Bo¨ttger.1990. Detection and identification of mycobacteria by amplification of rRNA. J. Clin. Microbiol. 28:1751–1759.

4. Bo¨ddinghaus, B., J. Wolters, W. Heikens, and E. C. Bo¨ttger.1990. Phyloge-netic analysis and identification of different serovars of Mycobacterium

in-tracellulare at the molecular level. FEMS Microbiol. Lett. 70:197–204.

5. Braun, M. M., R. H. Byers, W. L. Heyward, C. A. Ciesielski, A. B. Bloch, R. L.

Berkelman, and D. E. Snider.1990. Acquired immunodeficiency syndrome

and extrapulmonary tuberculosis in the United States. Arch. Intern. Med.

150:1913–1916.

6. Brisson-Noe¨l, A., C. Aznar, C. Chureau, S. Nguyen, C. Pierre, M. Bartoli, R.

Bonete, G. Pialoux, B. Gicquel, and G. Garrigue.1991. Diagnosis of

tuber-culosis by DNA amplification in clinical practice evaluation. Lancet 338:364– 366.

7. Butler, W. R., K. C. Jost, Jr., and J. O. Kilburn. 1991. Identification of mycobacteria by high-performance liquid chromatography. J. Clin. Micro-biol. 29:2468–2472.

8. Clarridge, J. E., III, R. M. Shawar, T. M. Shinnick, and B. B. Plikaytis. 1993. Large-scale use of polymerase chain reaction for detection of Mycobacterium

tuberculosis in a routine mycobacteriology laboratory. J. Clin. Microbiol. 31:

2049–2056.

9. Eisenach, K. D., M. D. Sifford, M. D. Cave, J. H. Bates, and J. T. Crawford. 1991. Detection of Mycobacterium tuberculosis in sputum samples using a polymerase chain reaction. Am. Rev. Respir. Dis. 144:1160–1163. 10. Ellner, J. J., A. R. Hinman, S. W. Dooley, M. A. Fischl, K. A. Sepkowitz, M. J.

Goldberger, T. M. Shinnick, M. D. Iseman, and W. R. Jacobs, Jr.1993.

Tuberculosis symposium: emerging problems and promise. J. Infect. Dis.

168:537–551.

11. Floyd, M. M., V. A. Silcox, W. D. Jones, Jr., W. R. Butler, and J. O. Kilburn. 1992. Separation of Mycobacterium bovis BCG from Mycobacterium

tubercu-losis and Mycobacterium bovis by using high-performance liquid

chromatog-raphy of mycolic acids. J. Clin. Microbiol. 30:1327–1330.

12. Ford, E. G., S. J. Snead, J. Todd, and N. G. Warren. 1993. Strains of

Mycobacterium terrae complex which react with DNA probes for M. tuber-culosis complex. J. Clin. Microbiol. 31:2805–2806.

13. Goodfellow, M., and L. G. Wayne. 1982. Taxonomy and nomenclature, p. 471–521. In R. Ratledge and J. Stanford (ed.), The biology of the mycobac-teria, vol. 1. Academic Press, London.

14. Goto, M., S. Oka, K. Okuzimi, S. Kimura, and K. Shimada. 1991. Evaluation of acridinium-ester-labeled DNA probes for identification of Mycobacterium

tuberculosis and Mycobacterium avium-Mycobacterium intracellulare complex

in culture. J. Clin. Microbiol. 29:2473–2476.

15. Groothuis, D. G., and M. D. Yates. 1991. European Society for Mycobacte-riology: manual of diagnostic and public health mycobacteriology. Bureau of Hygiene and Tropical Diseases, London.

16. Hampson, S. J., F. Portaels, J. Thompson, E. P. Green, M. T. Moss, J.

Hermon-Taylor, and J. J. McFadden.1989. DNA probes demonstrate a

single highly conserved strain of Mycobacterium avium infecting AIDS pa-tients. Lancet i:65–68.

17. Hermans, P. W. M., A. R. J. Schuitema, D. Van Soolingen, C. P. H. J.

Verstynen, E. M. Bik, J. E. R. Thole, A. H. J. Kolk, and J. D. A. van Embden.

Specific detection of Mycobacterium tuberculosis complex strains by poly-merase chain reaction. J. Clin. Microbiol. 28:1204–1213.

18. Hermans, P. W. M., D. van Soolingen, J. W. Dale, A. R. J. Schuitema, R. A.

McAdam, D. Catty, and J. D. A. van Embden.1990. Insertion element IS986

from Mycobacterium tuberculosis: a useful tool for diagnosis and epidemiol-ogy of tuberculosis. J. Clin. Microbiol. 28:2051–2058.

19. Hoffner, S. E. 1994. Pulmonary infections caused by less frequently encoun-tered slow-growing environmental mycobacteria. Eur. J. Clin. Microbiol. Infect. Dis. 13:937–941.

20. Hoffner, S. E., M. Haile, and G. Kållenius. 1992. A biphasic system for primary isolation of mycobacteria compared to solid medium and broth culture. J. Med. Microbiol. 37:332–334.

21. Horsburgh, C. R., Jr. 1991. Mycobacterium avium complex infection in the acquired immunodeficiency syndrome. N. Engl. J. Med. 324:1332–1338. 22. Hughes, M. S., R. A. Skuce, L. A. Beck, and S. D. Neil. 1993. Identification

of mycobacteria from animals by restriction enzyme analysis and direct DNA cycle sequencing of polymerase chain reaction-amplified 16S rRNA gene sequences. J. Clin. Microbiol. 31:3216–3222.

23. Jonas, V., M. J. Alden, J. I. Curry, K. Kamisango, C. A. Knott, R. Lankford,

J. M. Wolfe, and D. F. Moore.1993. Detection and identification of

Myco-bacterium tuberculosis directly from sputum sediments by amplification of

rRNA. J. Clin. Microbiol. 31:2410–2416.

24. Kirschner, P., B. Springer, U. Vogel, A. Meier, A. Wrede, M. Kiekenbeck,

F. C. Bange, and E. C. Bo¨ttger.1993. Genotypic identification of

mycobac-teria by nucleic acid sequence determination: report of a 2-year experience

on May 15, 2020 by guest

http://jcm.asm.org/

in a clinical laboratory. J. Clin. Microbiol. 31:2882–2889.

25. Kolk, A. H. J., G. T. Noordhoek, O. de Leeuw, S. Kuijper, and J. D. A. van

Embden.1994. Mycobacterium smegmatis strain for detection of

Mycobacte-rium tuberculosis by PCR used as internal control for inhibition of

amplifi-cation and for quantifiamplifi-cation of bacteria. J. Clin. Microbiol. 32:1354–1356. 26. Kolk, A. H. J., A. R. J. Schuitema, S. Kuijper, J. van Leeuwen, P. W. M.

Hermans, J. D. A. van Embden, and R. A. Hartskeerl.1992. Detection of

Mycobacterium tuberculosis in clinical samples by using polymerase chain

reaction and a nonradioactive detection system. J. Clin. Microbiol. 30:2567– 2575.

27. Kotloff, R. M. 1993. Infection caused by nontuberculous mycobacteria: clin-ical aspects. Semin. Roentgenol. 28:131–138.

28. Kox, L. F. F., S. Kuijper, and A. H. J. Kolk. Early diagnosis of tuberculous meningitis by polymerase chain reaction. Neurology, in press.

29. Kox, L. F. F., D. Rhienthong, A. Medo Miranda, N. Udomsantisuk, K. Ellis,

J. van Leeuwen, S. van Heusden, S. Kuijper, and A. H. J. Kolk.1994. A more

reliable PCR for detection of Mycobacterium tuberculosis in clinical samples. J. Clin. Microbiol. 32:672–678.

30. Kubica, G. P., W. E. Dye, M. L. Cohn, and G. Middlebrook. 1963. Sputum digestion and decontamination with N-acetyl-L-cysteine-sodium hydroxyde for culture of mycobacteria. Am. Rev. Respir. Dis. 87:775–779.

31. Kusunoki, S., and T. Ezaki. 1992. Proposal of Mycobacterium peregrinum sp. nov., nom. rev., and elevation of Mycobacterium chelonae subsp. abscessus (Kubica et al.) to species status: Mycobacterium abscessus comb. nov. Int. J. Syst. Bacteriol. 42:240–245.

32. Lebrun, L., F. Espinasse, J. D. Poveda, and V. Vincent-Levy-Frebault. 1992. Evaluation of nonradioactive DNA probes for identification of mycobacte-ria. J. Clin. Microbiol. 30:2476–2478.

33. Luquin, M., V. Ausina, F. Lo´pez Calahorra, F. Belda, M. Garcı´a Barcelo´, C.

Celma, and G. Prats.1991. Evaluation of practical chromatographic

proce-dures for identification of clinical isolates of mycobacteria. J. Clin. Microbiol.

29:120–130.

34. Mabilat, C., S. Desvarenne, G. Panteix, N. Machabert, M. H. Bernillon, G.

Guardiola, and P. Cros.1994. Routine identification of Mycobacterium

tu-berculosis complex isolates by automated hybridization. J. Clin. Microbiol.

32:2702–2705.

35. Masur, H., and the Public Health Service Task Force on Prophylaxis and

Therapy for Mycobacterium avium Complex. 1993. Recommendations on

prophylaxis and therapy for disseminated Mycobacterium avium complex disease in patients infected with the human immunodeficiency virus. N. Engl. J. Med. 329:898–904.

36. Miller, N., S. G. Hernandez, and T. J. Cleary. 1994. Evaluation of Gen-Probe Amplified Mycobacterium Tuberculosis Direct Test and PCR for direct detection of Mycobacterium tuberculosis in clinical specimens. J. Clin. Micro-biol. 32:393–397.

37. Miller, W. T., Jr., and W. T. Miller, Sr. 1993. Pulmonary infections with atypical mycobacteria in the normal host. Semin. Roentgenol. 28:139–149. 38. Nolte, F. S., B. Metchock, J. E. McGowan, Jr., A. Edwards, O. Okwumabua,

C. Thurmond, P. S. Mitchell, B. Plikaytis, and T. Shinnick.1993. Direct

detection of Mycobacterium tuberculosis in sputum by polymerase chain re-action and DNA hybridization. J. Clin. Microbiol. 31:1777–1782. 39. Pfyffer, G. E., P. Kissling, R. Wirth, and R. Weber. 1994. Direct detection of

Mycobacterium tuberculosis complex in respiratory specimens by a

target-amplified test system. J. Clin. Microbiol. 32:918–923.

40. Plikaytis, B. B., B. D. Plikaytis, M. A. Yakrus, W. R. Butler, C. L. Woodley,

V. A. Silcox, and T. M. Shinnick.1992. Differentiation of slowly growing

Mycobacterium species, including Mycobacterium tuberculosis, by gene

am-plification and restriction fragment length polymorphism analysis. J. Clin. Microbiol. 30:1815–1822.

41. Roberts, G. D., N. L. Goodman, L. Heifets, H. W. Larsh, T. H. Lindner, J. K.

McClatchy, M. R. McGinnis, S. H. Siddiqi, and P. Wright.1983. Evaluation

of the BACTEC radiometric method for recovery of mycobacteria and drug susceptibility testing of Mycobacterium tuberculosis from acid-fast smear-positive specimens. J. Clin. Microbiol. 18:689–696.

42. Rogall, T., J. Wolters, T. Flohr, and E. C. Bo¨ttger.1990. Towards a

phylog-eny and definition of species at the molecular level within the genus

Myco-bacterium. Int. J. Syst. Bacteriol. 40:323–330.

43. Saito, H., H. Tomioka, H. Tasaka, and D. J. D. Dawson. 1990. Identification of serovar strains of Mycobacterium avium complex by using DNA probes specific for Mycobacterium avium and Mycobacterium intracellulare. J. Clin. Microbiol. 28:1694–1697.

44. Scho¨ningh, R., C. P. H. J. Verstijnen, S. Kuijper, and A. H. J. Kolk.1990. Enzyme immunoassay for identification of heat-killed mycobacteria belong-ing to the Mycobacterium tuberculosis and Mycobacterium avium complexes and derived from early cultures. J. Clin. Microbiol. 28:708–713.

45. Sewell, D. L., A. L. Rashad, W. J. Rourke, Jr., S. L. Poor, J. A. C. McCarthy,

and M. A. Pfaller.1993. Comparison of the Septi-Chek AFB and BACTEC

systems and conventional culture for recovery of mycobacteria. J. Clin. Microbiol. 31:2689–2691.

46. Shafer, R. W., and M. F. Sierra. 1992. Mycobacterium xenopi, Mycobacterium

fortuitum, Mycobacterium kansasii, and other nontuberculous mycobacteria

in an area of endemicity for AIDS. Clin. Infect. Dis. 15:161–162. 47. Shinnick, T. M., and R. C. Good. 1994. Mycobacterial taxonomy. Eur. J. Clin.

Microbiol. Infect. Dis. 13:884–901.

48. Smithwick, R. W. 1976. Laboratory manual for acid-fast microscopy, 2nd ed. Centers for Disease Control, Atlanta.

49. Stager, C. E., J. P. Libonati, S. H. Siddiqi, J. R. Davis, N. M. Hooper, J. F.

Baker, and M. E. Carter.1991. Role of solid media when used in conjunction

with the BACTEC system for mycobacterial isolation and identification. J. Clin. Microbiol. 29:154–157.

50. Thierry, D., L. T. K. Tuyen, P. Chavarot, G. Marchal, H. M. Ly, N. N. Lan,

L. N. Van, S. Ledru, F. Fumoux, and J. L. Guesdon.1995. Mycobacterium

tuberculosis strains unidentified by using the IS6110 probe can be detected by

oligonucleotides derived from MT308 sequence, abstr. 456, p. 87. In Ab-stracts of the 7th European Congress of Clinical Microbiology and Infectious Diseases. European Society of Clinical Microbiology and Infectious Dis-eases, Vienna.

51. Thorel, M. F., M. Krichevsky, and V. Vincent Le´vy-Fre´bault. 1990. Numer-ical taxonomy of mycobactin-dependent mycobacteria, emended description of Mycobacterium avium, and description of Mycobacterium avium subsp.

avium subsp. nov., Mycobacterium avium subsp. paratuberculosis subsp. nov.,

and Mycobacterium avium subsp. silvaticum subsp. nov. 1990. Int. J. Syst. Bacteriol. 40:254–260.

52. Tsukamura, M. 1981. A review of the methods of identification and differ-entiation of mycobacteria. Rev. Infect. Dis. 3:841–861.

53. Van der Vliet, G. M. E., R. A. F. Schukkink, B. van Gemen, P. Schepers, and

P. R. Klatser.1993. Nucleic acid sequence-based amplification (NASBA) for

the identification of mycobacteria. J. Gen. Microbiol. 139:2423–2429. 54. Vaneechoutte, M., H. de Beenhouwer, G. Claeys, G. Verschraegen, A. de

Rouck, N. Paepe, A. Alachouni, and F. Portaels.1993. Identification of

Mycobacterium species by using amplified ribosomal DNA restriction

anal-ysis. J. Clin. Microbiol. 31:2061–2065.

55. Van Soolingen, D., P. E. W. de Haas, P. W. M. Hermans, P. M. A. Groenen,

and J. D. A. van Embden.1993. Comparison of various repetitive DNA

elements as genetic markers for strain differentiation and epidemiology of

Mycobacterium tuberculosis. J. Clin. Microbiol. 31:1987–1995.

56. Verstijnen, C. P. H. J., H. M. Ly, K. Polman, C. Richter, S. P. Smits, S. Y.

Maselle, P. Peerbooms, D. Rienthong, N. Montreewasuwat, S. Koanjanart,

D. D. Trach, S. Kuijper, and A. H. J. Kolk.1991. Enzyme-linked

immu-nosorbent assay using monoclonal antibodies for identification of mycobac-teria from early cultures. J. Clin. Microbiol. 29:1372–1375.

57. Vincent Le´vy-Fre´bault, V., and F. Portaels. 1992. Proposed minimal stan-dards for the genus Mycobacterium and for description of new slowly growing

Mycobacterium species. Int. J. Syst. Bacteriol. 42:315–323.

58. Wolinsky, E. 1992. Mycobacterial diseases other than tuberculosis. Clin. Infect. Dis. 15:1–12.

59. Woods, G. L., and J. A. Washington II. 1987. Mycobacteria other than

Mycobacterium tuberculosis; review of microbiologic and clinical aspects.

Rev. Infect. Dis. 9:275–294.

on May 15, 2020 by guest

http://jcm.asm.org/