Analysis of transcription factor binding sites
The demarcation of transcription factor binding sites through the analysis of DNase seq data
... how transcription factors can recognise DNA sequences in order to coordinate gene ex- ...occupied transcription factor bind- ing sites without the use of antibodies, as used in chromatin ...
174
Functional analysis of transcription factor binding sites in human promoters
... in binding motifs for functional classes of YY1 binding sites, with the repressing cases showing a pre- ference for G at position 4 of the motif (see Figure ...TF binding sites tended ...
16
Psoriasis drug development and GWAS interpretation through in silico analysis of transcription factor binding sites
... The goals of this study are to use expression profiling data from psoriasis lesions to identify TFs and cis-regu- latory elements mediating psoriasis plaque development. We identify differentially expressed genes (DEGs) ...
21
Analysis of variation at transcription factor binding sites in Drosophila and humans
... that binding sites that tolerate a higher load are less functionally ...since binding events limited to minor alleles are likely to be overlooked by a single-genome ChIP analysis, we com- pute ...
15
Comparative Analysis of Regulatory Motif Discovery Tools for Transcription Factor Binding Sites
... tion factor binding sites (TFBSs) in non-coding DNA sequences, which is essential to elucidate transcriptional regulatory networks, has emerged as an obstacle that frustrates many ...comparative ...
12
Reverse Genetic System for the Analysis of Parvovirus Telomeres Reveals Interactions between Transcription Factor Binding Sites in the Hairpin Stem
... coincident binding sites in the hairpin are thus required for both viral DNA replication and transcription from the P4 ...overlapping sites by creating viruses in which individual elements, ...
11
Statistics for Transcription Factor Binding Sites
... TFs are often represented as PFMs. As described in Section 2.4.4, the number of compat- ible words of a PFM depends on the chosen threshold selection method. Here, we focus on the selection methods based on the error ...
242
Why Transcription Factor Binding Sites Are Ten Nucleotides Long
... by transcription factors, whose DNA binding sites are typically 10 nt ...such binding sites evolve. Our analysis is based on an inherent trade-off between specificity, which is ...
23
Identification of transcription factor binding sites using ATAC seq
... Briefly, mouse bone marrow cells were first amplified with a specific cytokine cocktail and then induced to differen- tiate into DC with Flt3 ligand. cDC1 are CD11c+ CD11b+ XCR1+ and pDC are CD11c+ CD11b- B220+ and thus ...
21
The design of transcription factor binding sites is affected by combinatorial regulation
... the analysis described above, we also analyzed the number of binding sites upstream from genes whose knockout led to slow and fast growth in different growth mediums (Yeast Deletion Project ...
10
Developing algorithms for the in silico identification of transcription factor binding sites
... ConTrav2 During this PhD we developed an update to the previously published ConTra web-tool. This web-tool provides the wet-lab biologist with a user-friendly tool to interactively explore and visualize TFBSs, predicted ...
175
Mapping genome-wide transcription factor binding sites in frozen tissues
... more complex and heterogeneous, tissues are derived from an in vivo context that is subject to physiological conditions, and therefore the direct analysis of primary tissues should provide more relevant insights ...
10
Diversification at Transcription Factor Binding Sites within a Species and the Implications for Environmental Adaptation
... of sites having homopolymers of length 4 or more in com- putationally and experimentally identified sites ...our binding site substitution rate erroneously high, meaning we could incorrectly detect ...
55
Transcription factor binding sites are highly enriched within microRNA precursor sequences
... predicted transcription factor binding site motif that is conserved across human, mouse and rat, and this rises to over 75% if one excludes primate-specific ...separate analysis that examined ...
12
Integrating Epigenetic Priors For Improving Computational Identification of Transcription Factor Binding Sites
... predicting sites in a random DNA sequence ...and analysis in modern bioinformatics ...determined binding sites, in which a pattern (known as a motif ) is extracted by aligning the sequences to ...
108
Binding Motif And Transcription Factor
... and binding factor binding sites of two motifs is transcribed at the tbp dataset matching specific to the recent evolution of promoter ...known binding motif and wild type in distal ...
5
Locus-specific hypomethylation of the mouse IAP retrotransposon is associated with transcription factor-binding sites
... cing analysis revealed that specific IAP subfamilies were hypomethylated, whereas a vast majority were highly ...carried binding motifs for specific transcription factors ...
12
Novel Sequence-Based Method for Identifying Transcription Factor Binding Sites in Prokaryotic Genomes
... DNA binding ability to a consensus AP-1 probe (AGCTTCGCTTGATGAGTCAGCCG) 36 by electrophoretic mobility shift ...Batf binding sites in the IL-17, IL-21 and IL-22 ...DNA binding ability to a ...
230
Using an ensemble of statistical metrics to quantify large sets of plant transcription factor binding sites
... promoter-sequences of DEGs 10 dai from our prior soy- bean – soybean rust RNA-Seq study [36]. F-MATCH and Marina identify relatively the same number of over- represented TFBSs when promoter-sequence sets are 600 ...
11
Replicative senescence is associated with nuclear reorganization and with DNA methylation at specific transcription factor binding sites
... previous analysis with IlluminaBeadChip technology, which dis- covered highly consistent DNAm changes that are con- tinuously acquired throughout long-term culture [13,14,19], we would have anticipated a much ...
15