BLAST alignment for NRPS nucleotide sequence
Massively Parallel Sequence Alignment using pcj-blast
... BLAST - Basic Local Alignment Search Tool (1991) • The heuristic algorithm it uses is much faster than other approaches • The search time can be long (days or weeks) for large datasets NCBI-BLAST ...
20
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
... with sequence databases NCBI (The National Center for Biotechnology Information) accepts all submitted sequences and does not check whether the sequence is accurate or ...
37
BEAP: The BLAST Extension and Alignment Program a tool for contig construction and analysis of preliminary genome sequence
... of sequence mismatch that may represent possible ...between sequence reads. This nucleotide mismatch tool can be turned on or off as desired by the ...the sequence data that does not match the ...
5
An enhanced RNA alignment benchmark for sequence alignment programs
... RNA sequence sets in the benchmark database are taken from an increased number of RNA families to avoid unintended impact by using only a few ...performance. Alignment quality is scored by two measures: one ...
11
An enhanced RNA alignment benchmark for sequence alignment programs
... RNA sequence sets in the benchmark database are taken from an increased number of RNA families to avoid unintended impact by using only a few ...performance. Alignment quality is scored by two measures: one ...
11
Optimization of sequence alignment for simple sequence repeat regions
... SSR alignment tool (SALT) SALT is a new tool for making an alignment for SSR loci using the new ...last nucleotide position of the SSR locus in the whole ...the alignment, and the last for ...
9
Nucleotide Sequence Based Multitarget Identification
... signature nucleotide sequences of an stx 2 sequence of 30 nu- cleotides, followed by a lacZ sequence of 25 nucleotides and a lamB sequence of 24 ...A BLAST search of this ...
9
A mobile application on performing blast analysis and local alignment
... is BLAST. The next step was to implement the BLAST algorithm in a suitable ...The BLAST algorithm was then incorporated into an application for ...perform sequence alignment the ...
53
Div BLAST : diversification of sequence search results
... redundancy. Alignment and search tools need to perform diversifications tailored for each ...in sequence search and ...of sequence similarity search ...the sequence matches as bit ...
23
Bayesian coestimation of phylogeny and sequence alignment
... and sequence alignment, under the Thorne-Kishino-Felsenstein model of substitution and single nucleotide insertion-deletion (indel) ...fixed alignment, our extension analytically integrates ...
10
A RANDOMIZED ALGORITHM FOR FAST SEQUENCE ALIGNMENT
... possible alignment has a match score of 3, and the thin line shows the ...current alignment. This constitutes the nucleotide A of the 2 nd string in this case, which will be returned to the unsliced ...
5
Bioinformatics sequence alignment on a GRID architecture
... PALABRAS CLAvE: Computación HTC, Grid, Infraestructura Cluster, Condor, Blast. ANALYTICAL SUMMARY Tools such as high performance computational technologies have become very useful, used by research centers for ...
10
A Step Towards Sequence-to-Sequence Alignment
... Fig. 5 illustrates that temporal alignment is not limited to motion information alone. A light source was brightened and then dimmed down, resulting in observable illumination variations in the scene. The cameras ...
8
Pairwise Sequence Alignment
... a) A continuous main diagonal shows perfect similarity for symbols with the same indices. b) Parallels to the main diagonal indicate repeated regions in the same reading direction on different parts of the sequences. In ...
35
Figure S1. Sequence alignment of RBP proteins head domains. A. Sequence alignment of the RBP
... ATGGGAGTTAGCAAAGGTGAAGAACTGTTTACGGGCGTTGTGCCGATCCTGGTGGAACTGGACGGTGA TGTTAATGGTCATAAATTCTCTGTGAGTGGCGAAGGTGAAGGCGATGCGACCTATGGTAAACTGACGC TGAAATTTATTTGCACCACCGGTAAACTGCCGGTTCCGTGGCCGACCC[r] ...
15
DNA Sequence Alignment Analysis
... Click on the box by any set you want to omit, and the tick mark should go away. This sequence (or set of sequences) will no longer be included in analyses. To reverse this decision, click to get the tick back ...
20
Complete Nucleotide Sequence of Polyomavirus SA12
... Viral regulatory sequences. We have previously reported the sequence of the SA12 regulatory region (8). The ori regions of most characterized polyomaviruses consist of four GAGGC pentanucleotides flanked by ...
11
Nucleotide sequence of bacteriophage f1 DNA.
... (a) Plus-strand sequence obtained through the Pol 1-catalyzed extension of AluI-BlHha on the isolated minus strand of HgaI-C as the template; (b and c) minus-strand sequence obtained thr[r] ...
15
Nucleotide Sequence of the Akv env Gene
... This cleavage generates a region of 42 uncharged, relatively hydrophobic amino acids at the amino terminus of p1SE, which is located in a position analogous to the hydrophobic membrane f[r] ...
11
Minimum-risk sequence alignment for the alignment and recognition of action videos
... Temporal alignment of videos is an important requirement of tasks such as video compar- ison, analysis and ...temporal alignment are the human actions depicted in the ...well-established alignment ...
11