cyclin E
Drosophila Cdi4 is a p21/p27/p57-like cyclin-dependent kinase inhibitor with specificity for cyclin E complexes.
... Most bait plasmids are derived from pLEX(202+PL) (Ruden et al., 1991) or pEG202 (Estojak et al., 1995), which both contain the HIS3 gene, 2µm origin of replication, and the ADH1 promoter driving expression of fusion ...
15
Role of cyclin E in the pathogenesis of hepatocellular carcinoma
... of cyclin E, effects on cell cycle regulators and tumour suppressors, dysplastic liver and HCCs were studied in DEN-treated C57BL/6J female ...mice, cyclin E (native and LMW isoforms) protein ...
27
Adenovirus E1B55K Region Is Required To Enhance Cyclin E Expression for Efficient Viral DNA Replication
... for cyclin E (forward, AAGTACACCAGCCACC TCCAGA; reverse, CCCTCCACAGCTTCAAGCTTT) and -actin (forward, CGATCCACACGGAGTACTTG; reverse, GGATGCAGAAGGAGATCAC ...
13
Direct transdifferentiation of spermatogonial stem cells to morphological, phenotypic and functional hepatocyte-like cells via the ERK1/2 and Smad2/3 signaling pathways and the inactivation of cyclin A, cyclin B and cyclin E
... Additionally, cyclin A, cyclin B and cyclin E transcripts and proteins but not cyclin D1 or CDK1 and CDK2 transcripts or proteins were reduced in mature hepatocyte-like cells or hepatic ...
15
Functional Interaction between the Bovine Papillomavirus Virus Type 1 Replicative Helicase E1 and Cyclin E-Cdk2
... the cyclin E-Cdk2 kinase is most likely a cellular partner of the BPV replicative helicase ...E1, cyclin E, and Cdk2 added to Xenopus egg extracts through translation of their respective mRNAs ...
8
Sequential activation of cyclin E and cyclin A gene expression by human papillomavirus type 16 E7 through sequences necessary for transformation.
... p107, cyclin A, cyclin E, and cdk2 (13, 56; for a recent review, see reference 11), while interactions of cd1 with cellular proteins have not been ...ious cyclin genes in infected cells (4, ...
11
Disruption of the G1/S Transition in Human Papillomavirus Type 16 E7-Expressing Human Cells Is Associated with Altered Regulation of Cyclin E
... which cyclin D-CDK4 phosphorylation of Rb is required for S phase entry, Rb represses p16 mRNA transcription in a feedback loop to maintain CDK activity ...in cyclin E-associated kinase activity was ...
11
Analysis of a Drosophila cyclin E Hypomorphic Mutation Suggests a Novel Role for Cyclin E in Cell Proliferation Control During Eye Imaginal Disc Development
... for Cyclin A in S phase would be that in the eye, as in some embryonic tissues, dE2F and expected to be distinct from that of Cyclin E in the dDP interact with DmcycE to promote the G1 to S phase ...
16
Cyclin E overexpression as a biomarker for combination treatment strategies in inflammatory breast cancer
... identifies cyclin E as a biomarker for therapy in ...of cyclin E in a large cohort of IBC patient samples and demonstrated that the distribution of cyclin E immunophenotypes is ...
15
Original Article Does cyclin E and p57 kıp2 expression have prognostic and survival value in colorectal adenocarcinoma?
... of cyclin E in CRA carcinogenesis [11, ...defined cyclin E expression in 56% of adenocarcinomas; compared to this study we have found higher cyclin E expression rates of 80% in ...
9
The adenovirus E1A-associated kinase consists of cyclin E-p33cdk2 and cyclin A-p33cdk2.
... Experiments indicate that p33cdk2 is required early in the cell cycle prior to S phase, since microinjection of antibodies to this protein blocks DNA synthesis in diploid fibroblasts 104[r] ...
10
Cytomegalovirus infection induces high levels of cyclins, phosphorylated Rb, and p53, leading to cell cycle arrest.
... cyclins E, A, and B, and cyclin-dependent kinases cdk2 and cdc2 in HCMV-infected ...anti-cyclin E polyclonal antibody, with an anti-cyclin B1 monoclonal antibody, and with ...
8
Original Article Expression of cell-cycle regulators is associated with invasive behavior and poor prognosis in prolactinomas
... detectable cyclin E1, and express p27Kip1 ...that cyclin D1 and cyclin E1 are almost undetect- able in the normal pituitary, while p16 and p27 expression levels are relatively ...and E has ...
11
2,5-Dihydroxyacetophenone Induces Apoptosis of Multiple Myeloma Cells by Regulating the MAPK Activation Pathway
... of cyclin D1 and cyclin E by DHAP is associated with the suppression of proliferation and cell cycle arrest at the G2/M phase, suggesting that cyclin D1 and cyclin E may play a ...
16
WWC3 downregulation correlates with poor prognosis and inhibition of Hippo signaling in human gastric cancer
... Abstract: The aim of this study was to investigate the clinicopathological significance and biological roles of WWC3 in human gastric cancer (GC). Clinical significance of WWC3 in human GCs was examined by using ...
12
Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS
... by cyclin-CDK complexes via RB and E2F activates E2F target gene expression, which can be inhibited by pharmacological CDK ...of cyclin D or cyclin E: Copy number gain and overexpression of ...
19
G1/S phase cyclin dependent kinase overexpression perturbs early development and delays tissue specific differentiation in Xenopus
... of cyclin E can result in cells dividing at a smaller size than usual, but the final area occupied by overexpressing cells is normal as extra cells are lost by apoptosis (Li et ...while cyclin ...
10
The growth response to androgen receptor signaling in ERα negative human breast cells is dependent on p21 and mediated by MAPK activation
... Additionally, we examined the expression of cyclin E and cyclin D1, two key regulators of cell cycle progression [60] After 48 hours of treatment with R1881 in the presence of EGF, cycli[r] ...
17
Apoptosis signal-regulating kinase 1 exhibits oncogenic activity in pancreatic cancer
... ASK1, cyclin D, and cyclin E (Abcam), and horseradish peroxidase-conjugated secondary antibodies (Amersham Biosciences) were obtained from the indicated ...
10
Omega 3 polyunsaturated fatty acids inhibit cell proliferation by regulating cell cycle in fad3b transgenic mouse embryonic stem cells
... of cyclin D1 and cyclin E in one study [11], but decreased expression of the Cdk2 and cyclin E proteins and induced apoptosis in an- other study ...the cyclin ...
9