degenerate primers
Designing Of Degenerate Primers-Based Polymerase Chain Reaction (PCR) For Amplification Of WD40 Repeat-Containing Proteins Using Local Allignment Search Method
... Creating primers for degenerate PCR needs following several ...which degenerate primers are to be created are retrieved from Genbank ...gene. Primers created using these conserved ...
7
Sensitive, Seminested PCR Amplification of VP1 Sequences for Direct Identification of All Enterovirus Serotypes from Original Clinical Specimens
... when degenerate primers are used in a nested PCR assay, particularly when nucleic acids isolated from tissues or other high-complexity specimens are ...the degenerate core sequence to the template, ...
7
COX2 in a euryhaline teleost, Fundulus heteroclitus: primary sequence, distribution, localization, and potential function in gills during salinity acclimation
... osmoregulation. Degenerate primers, reverse transcription–PCR and rapid amplification of cDNA ends were used to deduce the complete cDNA sequence of a putative COX2 enzyme from the gills of the euryhaline ...
13
Detection and Serotyping of Dengue Virus in Serum Samples by Multiplex Reverse Transcriptase PCR Ligase Detection Reaction Assay
... multiple degenerate primers with a ligase detection reaction (LDR) and a universal zip-code array for the simultaneous identification and serotyping of DENV from viral cultures and clinical sam- ples from ...
9
Alternative oxidase in animals: unique characteristics and taxonomic distribution
... with degenerate primers designed to recognize conserved regions of animal AOX, we demonstrated that AOX genes are transcribed in several animals from different ...
8
Novel Endogenous Type D Retroviral Particles Expressed at High Levels in a SCID Mouse Thymic Lymphoma
... sequences. Degenerate primers for the human retroviruses human immunodeficiency virus type 1 (HIV-1) (45) and human T-cell leukemia virus (HTLV) type 1 (HTLV-1) (29) and for human (56) and mouse (51) type C ...
8
Termite Gut Symbiotic Archaezoa Are Becoming Living Metabolic Fossils
... design degenerate oligodeoxyribonucle- otides that encoded amino acid sequences conserved in an intrafamily (but not interfamily) manner for PCR amplification of the genes coding for specific cellulase family ...
8
Detection of a Novel Bovine Lymphotropic Herpesvirus
... LTR primers yield a 115-bp product in addition to the 173-bp BLHV ...with primers for BLHV and bovine actin, and all were positive for amplification of actin DNA target while remaining BLHV neg- ...the ...
6
Discovery and Phylogenetic Analysis of Novel Members of Class b Enterotoxigenic Escherichia coli Adhesive Fimbriae
... use degenerate primers to detect uncharacterized ETEC CFAs belonging to class 1b ...the degenerate primer pairs indicated that members of ETEC class 1b fimbriae could be clustered into five different ...
8
The transcriptional apparatus of Chlamydomonas chloroplasts
... A series of degenerate primers were designed to conserved regions of plant nuclear encoded mitochondrial and chloroplast RNA polymerases, yeast nuclear encoded mit[r] ...
263
A Conserved Motif within the Vitamin K-dependent Carboxylase Gene Is Widely Distributed across Animal Phyla
... region of the bovine carboxylase. No product was observed after primary amplification with cDNA templates from hagfish liver, cone snail venom duct, and horseshoe crab hepatopancreas or blood using degenerate ...
7
Simultaneous Analysis of Multiple Staphylococcal Enterotoxin Genes by an Oligonucleotide Microarray Assay
... with degenerate primers, followed by characterization of the PCR products by microchip hybridization with oligonucleotide probes specific for each ent ...gene-specific primers, followed by gel ...
10
Identification of cytochrome P450 monooxygenase genes from the white-rot fungus Phlebia brevispora
... Kamei et al. (2006) reported the congener-specific meta- bolism of 3,3 ’ ,4,4 ’ -tetrachlorobiphenyl, 2,3,3 ’ ,4,4 ’ -penta- chlorobiphenyl, 2,3 ’ ,4,4 ’ ,5-pentachlorobiphenyl, 3,3’,4,4’,5-pentachlorobiphenyl and ...
10
Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein
... and degenerate primers (Table 1) that were designed based on highly-conserved sequences in the coding regions of several members of PR-1 family found in ...
6
Survey of methanotrophic diversity in various ecosystems by degenerate methane monooxygenase gene primers
... or degenerate primers are still of high impor- tance, especially in ecological studies where many samples need to be investigated or ...based primers are over 10 years old and since known MOB ...
11
Pipeline for specific subtype amplification and drug resistance detection in hepatitis C virus
... Amplification products were analyzed by 2% agarose gel electrophoresis using GeneRuler 1 kb Plus DNA Ladder (Thermo Scientific) as the molar mass standard, and purified using QIAquick gel extraction kit (Qiagen). ...
15
Use of PGMY Primers in L1 Consensus PCR Improves Detection of Human Papillomavirus DNA in Genital Samples
... ples, types 58, 31, and 33 in 1 sample each) that was not detected with PGMY-line blot. In all cases, the signals ob- tained in the dot blot assay were weak. There was a signifi- cantly greater proportion of multiple HPV ...
6
The N Acylneuraminate Cytidyltransferase Gene, neuA, Is Heterogenous in Legionella pneumophila Strains but Can Be Used as a Marker for Epidemiological Typing in the Consensus Sequence Based Typing Scheme
... designed degenerate consensus primers based on the neuA homolog in strains Dallas-1E, Philadelphia-1, Paris, Lens, and Corby, we were able to obtain DNA sequences for all 48 non-SG1 strains which were ...
7
Cloning and functional expression of voltage gated ion channel subunits from cnidocytes of the Portuguese Man O'War Physalia physalis
... exact primers (GTTACAGCTTCGTACAATGTTCCTCT and CCA- TATTCTGAAGATGTACCAGAAGTT), which amplified a 323·bp region at the 5 ⬘ end of the coding ...exact primers (CCAGCAAGCATCAGGGTTAT [sense] and ACTATAG- ...
11
Cloning of the mouse hepatitis virus (MHV) receptor: expression in human and hamster cell lines confers susceptibility to MHV.
... A segment of cDNA from BALB/c mouse colon was amplified by RNA polymerase chain reaction PCR by using degenerate oligonucleotide primers on the basis of the N-terminal amino acid sequenc[r] ...
11