Exon 1
tat Exon 1 Exhibits Functional Diversity during HIV-1 Subtype C Primary Infection
... To our knowledge, this is the first in-depth functional character- ization of tat exon 1 during primary HIV-1 subtype C infection. We employed the recently developed MEME method for detecting ...
14
The Human Cytomegalovirus Protein UL37 Exon 1 Associates with Internal Lipid Rafts
... UL37 exon 1 (pUL37x1), also known as viral mitochondrion- localized inhibitor of apoptosis (vMIA), sequentially traffics from the endoplasmic reticulum (ER) through mitochondrion-associated membranes (MAMs) ...
12
Alternatively spliced mu opioid receptor C termini impact the diverse actions of morphine
... the exon-exon junctions of reverse-transcription PCR (RT-PCR) products from brain total RNAs confirmed that all the stop codon mutations were present, as expected (Supplemental Figure ...from exon ...
14
Molecular Mechanisms of Alternative Splicing Regulation: An Investigation of the Spliceosome Repressed by Hnrnp L on Cd45 Exon 4
... of exon 4 by an anti- sense oligo disrupts ESS1-medaited splicing ...of exon 4 go does not overcome the ESS1-mediated splicing repression on the upstream ...of exon 4 is required for ESS1- and hnRNP ...
133
Identification of Closely Spaced but Distinct Transcription Initiation Sites for the Murine Gammaherpesvirus 68 Latency-Associated M2 Gene
... between exon 1 and exon 2 of the M2 transcript; (ii) the identification of clustered but distinct M2 gene transcription initiation sites suggesting the presence of multiple promoters involved in ...
11
Musculoskeletal manifestations occur predominantly in patients with later onset familial Mediterranean fever: Data from a multicenter, prospective national cohort study in Japan
... in exon 10 mutations, which is high penetrance, are associated with earlier on- set and severe phenotypes [27, 28], suggesting an associ- ation between high penetrance and earlier ...MEFV exon 10 mutations ...
13
Identification of a new exon 2-skipped TNFR1 transcript: Regulation by three functional polymorphisms of the TNFR-associated periodic syndrome (TRAPS) gene
... While the rs1800692 genotypic distribution was comparable in our controls and in the TRAPS-like group, only one T/T homozygote carrying a p.Thr79Lys (usual name T50K) mutation (c.236C>A) 5 was present in 111 available ...
19
Identification of New Viral Genes and Transcript Isoforms during Epstein-Barr Virus Reactivation using RNA-Seq
... intron 1 and intron 2, respectively. Eighty-one reads spanning the exon 1-exon 3 splicing event correspond to the dominant-negative variant ...stand-alone exon since no ...
10
Transduction of c-src coding and intron sequences by a transformation-defective deletion mutant of Rous sarcoma virus.
... The joining of exon 1 to the 5' end of the internal intron 1 sequence transduced into the rASV382 genome appears to be formed by splicing between exon 1 donor site and a cryptic acceptor[r] ...
8
8q24 amplified segments involve novel fusion genes between NSMCE2 and long noncoding RNAs in acute myelogenous leukemia
... PVT1 exon 1a and NSMCE2 exon 3 in the patient (Figure 1d and e), and a fusion gene between exon 6 of NSMCE2 and exon 1 of BF104016, a noncoding RNA sharing the sequence of CCDC26 ...
5
The carnitine acetyltransferase gene (CRAT): A characterization of porcine transcripts with insights into the 5’-end variants of mammalian transcripts and their possible sub-cellular localization
... variant 1 is the result of the transcription described in ...exons 1 and 2 is 2405 ...alternative exon 1 is found in normal intron 1 and the beginning of the translation is reported to ...
10
PGBD5: a neural-specific intron-containing piggyBac transposase domesticated over 500 million years ago and conserved from cephalochordates to humans
... PGBD5 exon 1 is typically located far upstream from exons 2–7, and is embedded in a CpG island that is rich in bound neural transcriptional and regulatory ...
17
PDGFRA exon 12 (5 cases, 5%), PDGFRA exon 14 (1 cases, 1.0%), PDGFRA exon 11 (1 cases, 1.0%),
... EXON 1 FORWARD gccccattgattctttcatc EXON 1 FORWARD cggaaaatctgaccggcg EXON 1 REVERSE aactgccactggagagcatt EXON 1 REVERSE tgagctcttggttgggctc EXON 2 FORWARD ...
6
The proximal first exon architecture of the murine ghrelin gene is highly similar to its human orthologue
... extended exon 1- containing Ghrl transcripts by transcript profiling in 36 normal mouse ...extended exon 1 species are predominantly expressed in the spleen, adrenal gland, stomach, skin, ...
7
PEG10 as an oncogene: expression regulatory mechanisms and role in tumor progression
... The exon 1 of PEG10 con- tains the 5 ′ -untranslated region (UTR) and exon 2 contains two overlapping open reading frames (ORFs) and a 4 kb 3 ′ -UTR sequence ...− 1 frameshifting, the ORF1 and ...
10
PubMedCentral-PMC5105168.pdf
... AKAP95 binds to RNA processing factors at its N-terminus. Because the N-terminal region (1–100 residues) of AKAP95 is highly enriched with Tyr-Gly (YG) motifs (Fig. 1a and Supplementary Fig. 1a) and required for ...
12
RNA-seq analysis of Lgr6(+) stem cells and identification of an Lgr6 isoform
... Lgr6-EGFP-Ires-CreERT2/R26R-LacZ transgenic mice (kindly provided by Prof. Hans Clevers) were backcrossed into a hairless background using Crl:SKH1-HR hairless mice (Charles River, Sulzfeld, Germany). Both homozygous and ...
33
Gene Expression Regulation by the 5' Regulatory Sequences of the Rice rubi3 Gene in Transgenic Rice Plants
... intron 1 from the maize Shrunken-1 (Sh1) gene enhanced CAT gene expression in rice and maize protoplasts approximately 100-fold but inhibited the reporter gene expression in tobacco protoplasts (Maas et ...
87
The ICR639 CPG NGS validation series: A resource to assess analytical sensitivity of cancer predisposition gene testing.
... at 1, the A of the ATG translation initiation codon. For WT1, c.1 is the A of the first in-frame AUG translation initiation codon and the KTS exon 9 sequence is ...for exon CNV annotation as ...
8
Generation of Acsl4 Gene Knockout Mouse Model by CRISPR/Cas9-Mediated Genome Engineering
... Porcine intramuscular fat (IMF) content is considered one of the most important traits of pork quality, and has been positively correlated with meat tenderness, moisture content and taste [1]. Therefore, it is ...
5