Human peripheral blood mononuclear cells
Short-Chain Fatty Acids Regulate Cytokines and Th17/Treg Cells in Human Peripheral Blood Mononuclear Cells in vitro
... Key words: Short chain fatty acids, Human peripheral blood mononuclear cells, Cytokines, 29.. Immune modulation, T helper cells, Th17 and CD4 + CD25 + Treg cells..[r] ...
37
Anti-inflammatory effects of the Portulaca oleracea hydroalcholic extract on human peripheral blood mononuclear cells
... Portulaca oleracea (P. oleracea, Family Portulaca- ceae), also known as Purslane, is an annual growing herb listed in the World Health Organization as one of the most used therapeutic plants (7,8). P. oleracea is an ...
6
Acanthamoeba castellanii (genotype T4) stimulates the production of interleukin-10 as well as pro-inflammatory cytokines in THP-1 cells, human peripheral blood mononuclear cells and human monocyte-derived macrophages
... Amoeba culture conditions. Our study was performed using tropho- zoites of A. castellanii genotype T4 (20, 21), isolated from the corneal ulcer of a soft contact lens wearer (in Ancona, Italy) and axenically grown at ...
10
Definition of a subset of human peripheral blood mononuclear cells that are permissive to human cytomegalovirus infection.
... Difference in expression of HCMV IE and E antigensa in in vitro-infected PBMC cultured in FCS or AB serum and content of infectious virus" HCMV antigen or plaques Phenotype of cells expr[r] ...
10
Optimization of human peripheral blood mononuclear cells (PBMCs) cryopreservation
... (PHA induced PBMCs proliferation) did not show any significant differences among the groups. This assay basically evaluate the function of PBMCs to proliferate in response to a mitogen (PHA). Since we have used a ...
6
Chemical and immunological characterisation of glycophospholipid and phospho-oligosaccharide from mycobacteria
... adherent human peripheral blood mononuclear cells in ...fresh human PBMCs (2 X 10^ cells per well) were cultured at in an experiment identical to that represented in ...
246
Synthesis of antimicrobial silver nanoparticles through a photomediated reaction in an aqueous environment
... the human keratinocyte cell line and human peripheral blood mononuclear cells revealed that their cytotoxicity may be limited by modulating the employed concentrations of ...
10
Cytotoxic and genotoxic potential of geraniol in peripheral blood mononuclear cells and human hepatoma cell line (HepG2).
... two human cell types: i) human peripheral blood mononuclear cells (PBMC), and ii) human hepatoma cell line (HepG2), respectively, to evaluate its direct effects and after ...
12
Immunomodulatory mechanisms of lactobacilli
... immune cells or epithelial cells lining the mucosa to modulate specific functions of the mucosal immune ...presenting cells and modulate their function through the expression of surface receptors, ...
15
s41590-019-0416-z.pdf
... uniquely human immune ...with human cells or tissues — i.e., ‘humanized’ mice or ‘human immune system’ (HIS) mice ...with human cells and tissues serve as a preclinical bridge ...
5
Differential processing of proenkephalin A by human peripheral blood monocytes and T lymphocytes
... Human peripheral blood mononuclear cells are analyzed for preproenkephalin gene expression and peptide ...T cells that were activated with PHA and ...
9
Recovery of Pathogenic Measles Virus from Cloned cDNA
... B95a cells (34, 35), as a tag (Fig. 1). Pathogenic MeV isolated in B95a cells will grow only in lymphoid cells such as human peripheral blood mononuclear cells ...
5
<p>Selective purging of human multiple myeloma cells from peripheral blood mononuclear cells: a preliminary study</p>
... was added and then gently mixed. The tubes were centrifuged for 5 minutes at 540 g and the supernatant was removed. The washing with PBS and removal of the supernatant were repeated twice. Then, cells were stained ...
5
Peripheral blood derived mononuclear cells enhance osteoarthritic human chondrocyte migration
... chondrogenic cells (chemotaxis), 2) stimulation of chondrogenic cell prolif- eration (mitogenesis) and 3) enhancement of cartilage matrix ...the peripheral blood and reach articular cartilage through ...
10
VPAC1 receptor expression in peripheral blood mononuclear cells in a human endotoxemia model
... different blood cells, FACS analysis was performed from whole ...4°C blood cells were washed with FACS buffer (phosphate buffered saline supplemented with 8 mM EDTA, ...
6
Augmentation of virus secretion by the human immunodeficiency virus type 1 Vpu protein is cell type independent and occurs in cultured human primary macrophages and lymphocytes.
... The human immunodeficiency virus type 1-specific Vpu protein is a small integral membrane phosphopro- tein that induces degradation of the virus receptor CD4 in the endoplasmic reticulum and, independently, ...
13
Ex Vivo Stimulation and Expansion of both CD4+ and CD8+ T Cells from Peripheral Blood Mononuclear Cells of Human Cytomegalovirus-Seropositive Blood Donors by Using a Soluble Recombinant Chimeric Protein, IE1-pp65
... transfected U373MG astrocytoma cells (8) using a reverse transcriptase-PCR Superscript kit (Gibco). Primers corresponding to the 5⬘ and 3⬘ ends of IE1 cDNA were GATCCGGATCCATGGAGTCCTCTGCCAAGAGA, with a BamHI ...
8
Resistance to Replication of Human Immunodeficiency Virus Challenge in SCID-Hu Mice Engrafted with Peripheral Blood Mononuclear Cells of Nonprogressors Is Mediated by CD8+T Cells and Associated with a Proliferative Response to p24 Antigen
... levels of virus in plasma are a heterogeneous group, a small subgroup of patients with truly nonprogressive human immu- nodeficiency virus (HIV) infection likely hold important clues to the basis of an effective ...
6
Neonatal Fc receptor is involved in the protection of fibrinogen after its intake in peripheral blood mononuclear cells
... HSA: human serum albumin; IgG: immunoglobu- lin G-type; IL-6: interleukin 6; MACS: magnetic-activated cell sorting; PBMCs: peripheral blood mononuclear cells; PBS: phosphate-buffered ...
13
The multi-differentiation potential of peripheral blood mononuclear cells
... the human HLA positive cells, suggesting no cell membrane fusion between trans- planted cells and host ...transplanted human PBMC-derived CD34+ cells into the infarcted myocardium of ...
10