• No results found

Human Prostate Cancer

The role of QRFP & GPR103 in human prostate cancer

The role of QRFP & GPR103 in human prostate cancer

... The human QRFP gene was discovered using a search of the DNA sequence ...in human (GPR103), and two types of receptors GPR103a and b has been identified in ...in human prostate cancer ...

282

Enrichment of Prostate Cancer Stem-Like Cells from Human Prostate Cancer Cell Lines by Culture in Serum-Free Medium and Chemoradiotherapy

Enrichment of Prostate Cancer Stem-Like Cells from Human Prostate Cancer Cell Lines by Culture in Serum-Free Medium and Chemoradiotherapy

... of cancer stem cells (CSCs) has created a new focus in cancer ...other cancer cells, this allows the enrichment of CSC populations by killing apoptosis-susceptible cancer ...used human ...

8

Elevated expression of UBE2T exhibits oncogenic properties in human prostate cancer

Elevated expression of UBE2T exhibits oncogenic properties in human prostate cancer

... in human prostate ...in prostate cancer development remains ...in prostate carcinogenesis. Prostate cancer tissue array analysis confirmed upregulation of UBE2T in ...

14

DESNT : a poor prognosis category of human prostate cancer

DESNT : a poor prognosis category of human prostate cancer

... DESNT cancer exhibited poor outcome relative to other patients (p = ...of prostate-speci fi c antigen failure was ...of human prostate cancer and will assist in the targeting of therapy, ...

9

SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia

SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia

... In human colorectal, breast, and endometrial cancers, expression of the Scribble complex member SCRIB is often mislocalized and ...for prostate homeostasis in mice. Scrib heterozygosity initiated ...

12

Transcriptional programs activated by exposure of human prostate cancer cells to androgen

Transcriptional programs activated by exposure of human prostate cancer cells to androgen

... in human prostate cancer ...these prostate cancer cell lines retain features of pro- static epithelial cells, despite being derived from prostate cancer metastases and ...

12

MPC1, a key gene in cancer metabolism, is regulated by COUP- TFII in human prostate cancer

MPC1, a key gene in cancer metabolism, is regulated by COUP- TFII in human prostate cancer

... in prostate cancer, we overexpressed MPC1 in prostate cancer cells using lentivirus delivered MPC1 with C terminal flag tag (Figure ...of prostate cancer cells as indicated by ...

11

Characterization of Human Prostate Cancer Using Sodium Magnetic Resonance Imaging

Characterization of Human Prostate Cancer Using Sodium Magnetic Resonance Imaging

... First, would like to acknowledge my supervisor, Dr. Timothy Scholl for his guidance and support throughout my master’s studies. I feel as if I couldn’t express how appreciative I am for the opportunity he provided me ...

113

Human papillomavirus is the cause of human prostate cancer

Human papillomavirus is the cause of human prostate cancer

... among children, adolescents and adults, 2010-2012: a cross-sectional study part 2, BMJ Open, 2017; 7(12):016559. doi: https://doi.org/10.1136/bmjopen-2017-016559 [PMID: 29273649] 13. Pernar CH, Ebot EM, Wilson KM, Mucci ...

12

The activation of OR51E1 causes growth suppression of human prostate cancer cells

The activation of OR51E1 causes growth suppression of human prostate cancer cells

... To ascertain a possible influence of NA on AR signaling, we performed ICC to investigate the protein expression and subcellular localization of AR upon NA stimulation in LNCaP cells. We found that NA causes a decrease in ...

19

Quantification of Mesenchymal Stem Cells (MSCs) at Sites of Human Prostate Cancer

Quantification of Mesenchymal Stem Cells (MSCs) at Sites of Human Prostate Cancer

... to prostate cancer lesions ...the prostate during tissue regrowth [54], carcinogenesis (Figure 3, Table 2), and inflammation-associated pathologies, such as BPH ...to prostate regrowth ...

12

Androgen receptor expression in human prostate cancer cell lines

Androgen receptor expression in human prostate cancer cell lines

... the human AR cDNA is driven by a heterologous promoter (P c m v ), ARE sequences have been identified within the AR cDNA and not in CMV promoter sequences (Bumstein et ...

230

The early effects of rapid androgen deprivation on human prostate cancer

The early effects of rapid androgen deprivation on human prostate cancer

... In addition to identifying a large number of AR-regulated genes, we have confirmed AR regulation of three genes (RAB27A, FAM129, and KIAA0101) not proven to be AR regulated in vivo as well as AMACR, for which data were ...

5

SULF2 overexpression positively regulates tumorigenicity of human prostate cancer cells

SULF2 overexpression positively regulates tumorigenicity of human prostate cancer cells

... published: human SULF2 F: CTGTGGGAAGGCTGGGAAGG and R: TGAGAGTGCGTGCTTGCTTTC; human beta-actin F: ACCAACTGGGACGACATGGAGAAA and R: TAGC ACAGCCTGGATAGCAACGTA; human GAPDH F: TC GACAGTCAGCCGCATCTTCTTT ...

16

Prostate stem cell antigen (PSCA) expression in human prostate cancer tissues and its potential role in prostate carcinogenesis and progression of prostate cancer

Prostate stem cell antigen (PSCA) expression in human prostate cancer tissues and its potential role in prostate carcinogenesis and progression of prostate cancer

... The cause of PSCA overexpression in Pca is not known. One possible mechanism is that it may result from PSCA gene amplification. In humans, PSCA is located on chro- mosome 8q24.2 [1], which is often amplified in meta- ...

7

Identification of biomarkers for the management of human prostate cancer

Identification of biomarkers for the management of human prostate cancer

... fresh prostate cancer specimens obtained from a systematic series of patients who had undergone prostatectomy at the Royal Marsden NHS Foundation Trust and Addenbrooke’s Hospital, Cambridge, ...Frozen ...

334

Inducible expression of cancer-testis antigens in human prostate cancer

Inducible expression of cancer-testis antigens in human prostate cancer

... of cancer therapies as preclinical data has demonstrated potent and wide-ranging anti-tumor effects when administered in low, biological ...in human PC and that EMA treatments enhance CTA expression and ...

16

DESNT: A Poor Prognosis Category of Human Prostate Cancer.

DESNT: A Poor Prognosis Category of Human Prostate Cancer.

... in human cancer, as is the association of CpG methylation of single genes with aggressive cancer behavior (Supplemental Table ...of cancer progression and ...DESNT cancer (ACTA2, CNN1, ...

17

SPOCK1 promotes tumor growth and metastasis in human prostate cancer

SPOCK1 promotes tumor growth and metastasis in human prostate cancer

... Furthermore, we performed Western blot analysis of SPOCK1 in five prostate cancer cell lines. Our data showed that SPOCK1 in these cell lines was differentially expressed, with its highest expression ...

11

EphA6 promotes angiogenesis and prostate cancer metastasis and is associated with human prostate cancer progression

EphA6 promotes angiogenesis and prostate cancer metastasis and is associated with human prostate cancer progression

... Total RNA was isolated using Trizol from four samples: PC-3M/shEphA6-1, PC3M/shControl, CWR22rv1/shEphA6-1, and CWR22rv1/shControl cell line. RNA were quantified using NanoDrop-1000 spectrophotometer and evaluated for ...

11

Show all 10000 documents...

Related subjects