Lentiviral Vector
Original Article Lentiviral vector-mediated over-expression of Sox9 protected chondrocytes from IL-1β induced degeneration and apoptosis
... over-expressing vector delivery system in which the Sox9 gene was inserted into a lentiviral ...Sox9-encoding vector, we observed a high level of gene transduction efficiency and achieved a high ...
12
Lentiviral vector transduction of spermatozoa as a tool for the study of early development
... to lentiviral encoded, de novo GFP synthesis, we per- formed experiments to block the expression of GFP, either with the HIV reverse transcriptase inhibitor, azidodeoxy thimidine (AZT) ...the lentiviral ...
10
Development of a Pseudotyped Lentiviral Vector Based Neutralization Assay for Chikungunya Virus Infection
... CHIKV-pseudotyped lentiviral vector transduced three cell lines that are permissive for CHIKV infection, but the trans- duction was less efficient than that with a VSV-pseudotyped len- tiviral vector ...
7
Factors affecting the formation, stability, and expression of unintegrated lentiviral vector genomes
... of vector particles; however, the present study, for the first time, administered nonintegrating lentiviral vectors systemically to slowly dividing liver cells, which allowed testing of the vector’s ...
122
Lentiviral vector design using alternative RNA export elements
... Other RNA export sequences from murine origin known as intracisternal A-type particles (IAP) were examined for their function on viral titer. In our hands, we found that the insertion of a single RNA export element from ...
10
Design and In Vitro Characterization of a Single Regulatory Module for Efficient Control of Gene Expression in Both Plasmid DNA and a Self-Inactivating Lentiviral Vector
... In the present study, a modified version of this tetracycline-inducible system was used to create a single inducible cassette that provides simultaneous expression of both the target transgene and its mod- ulator tetR ...
11
Ubiquitous GFP expression in transgenic chickens using a lentiviral vector
... derived lentiviral vector (Tranzyme LLC; RTP, North Carolina) was used because of its ability to integrate into the genome of dividing and non-dividing cells, significantly increasing the host cell ...
7
Coordinate enhancement of transgene transcription and translation in a lentiviral vector
... of vector transgene ...of vector transgene ...during vector con- ...of lentiviral vector transgene ...self-inactivating lentiviral vectors that lack or contain PCE translation ...
10
Efficient expansion of human keratinocyte stem/progenitor cells carrying a transgene with lentiviral vector
... lentivirus vector in the presence or absence of Y-27632, and grown for seven ...recombinant lentiviral vector, 5′- TGA TTATTGGTGGTGGAATGGCTT and 5′-TGGAGGT CAGCATCTATACTAAGA for the human PGK gene, ...
12
Overexpression of thioredoxin in islets transduced by a lentiviral vector prolongs graft survival in autoimmune diabetic NOD mice
... Thioredoxin (TRX) is a small, ubiquitously expressed pro- tein in the cell. TRX has many biological functions includ- ing the regulation of the cellular reduction-oxidation balance, promotion of cell growth, inhibition ...
10
Development of an Avian Leukosis-Sarcoma Virus Subgroup A Pseudotyped Lentiviral Vector
... self-inactivating lentiviral vector plasmid pCS-CG expressing green fluorescent protein (GFP) from an internal cytomegalovirus (CMV) pro- moter was used as a transfer vector ...
6
Lentiviral vector integration in the human genome induces alternative splicing and generates aberrant transcripts
... retroviral vector integration on transcript splicing, we transduced primary human cells or cultured cells with HIV-derived vectors carrying a reporter gene or a human β-globin gene under the control of a ...
15
Hepatitis B virus inhibition in mice by lentiviral vector mediated short hairpin RNA
... that lentiviral vector trans- duction efficiency and transgene expression were signifi- cantly enhanced in adolescent (3 1/2 weeks of age) mice compared to older (7 weeks of age) ...and lentiviral ...
11
Development of a tetracycline inducible lentiviral vector with an instant regulatory system : a thesis presented in partial fulfillment of the requirements for the degree of Master of Science (MSc) in Biochemistry at Massey University, Manawatu, New Zealand
... these lentiviral vectors was confirmed by transient transfection in HEK 293T ...each lentiviral vector for ...novel vector can be used in transient transfection for inducible gene expression; ...
106
Targeted Transduction via CD4 by a Lentiviral Vector Uses a Clathrin-Mediated Entry Pathway
... geting vector which acquires specific transduction capacity by antibody conjugation and binding to specific antigens on the surface of targeted ...The lentiviral vector pseudotyped by this modified ...
6
Potent and reversible lentiviral vector restriction in murine induced pluripotent stem cells
... It was previously shown that permissiveness of specific cell types to HIV-1 can be enhanced by altering the viral entry route [17, 18]. Therefore, we performed a side-by- side comparison of envelope pseudotypes used for ...
15
Delivery of Factor VIII Gene into Skeletal Muscle Cells Using Lentiviral Vector
... virus vector conferred sustained FVIII expres- sion in hemophilia A mice for several months (7 months) without developing anti-human FVIII antibodies and further resulted in partial phenotypic ...and vector ...
6
Whole transcriptome characterization of aberrant splicing events induced by lentiviral vector integrations
... Gamma-retroviral/lentiviral vectors (gRV/LV) with self-inactivating (SIN) long terminal repeats (LTRs) and internal moderate cellular promoters pose a reduced risk of insertional mutagenesis when compared with ...
11
Simian immunodeficiency virus Vpx for improving integrase defective lentiviral vector based vaccines
... Non-human primates (NHP) represent an important model for evaluating vaccine approaches against many infectious diseases such as HIV-1, malaria and tubercu- losis. To evaluate if the use of IDLV/Vpx might be ad- ...
13
A New Hybrid System Capable of Efficient Lentiviral Vector Production and Stable Gene Transfer Mediated by a Single Helper-Dependent Adenoviral Vector
... LA vector system would have more advantages than currently available ...LA vector system can infect nondividing cells both in the adenoviral stage and in the second LV stage, thereby enhancing the ...
8