M. tuberculosis
IDENTIFICATION OF M. tuberculosis
... According to the World Health Organization recommendations, it is imperative that all mycobacteria isolates be identified at least to the level of M. tuberculosis complex vs. non- tuberculous mycobacteria ...
7
Comparative Evaluation of PCR with Commercial Multiplex M tuberculosis Detection Kit
... On the other side, the PCR positivity was found 100% in smear positive samples by utilizing In House PCR as well as commercial multiplex M. tuberculosis PCR kit. One culture positive & smear negative ...
8
A Highly Efficient Ziehl Neelsen Stain: Identifying De Novo Intracellular Mycobacterium tuberculosis and Improving Detection of Extracellular M tuberculosis in Cerebrospinal Fluid
... Mycobacterium tuberculosis is a kind of cytozoic pathogen and its numbers are very few in cerebrospinal fluid, detecting ...M. tuberculosis in cerebrospinal fluid from tuberculous meningitis patients ...
5
Use of Enzyme Linked Immunospot Assay with Mycobacterium tuberculosis Specific Peptides for Diagnosis of Recent Infection with M tuberculosis after Accidental Laboratory Exposure
... conclude definitively that responses to TB37.6 are found ex- clusively in recently infected individuals, and the observation could be coincidental. Further studies are needed to validate our findings. In both ...
5
Lack of intracellular replication of M. tuberculosis and M. bovis BCG caused by delivering bacilli to lysosomes in murine brain microvascular endothelial cells
... Mycobacterium tuberculosis cause meningeal tuberculosis (TB) in the central nervous system ...by M. tuberculosis bacilli are poorly ...of M. tuberculosis and ...intracellular ...
12
Multidrug Resistant Tuberculosis in Panama Is Driven by Clonal Expansion of a Multidrug Resistant Mycobacterium tuberculosis Strain Related to the KZN Extensively Drug Resistant M tuberculosis Strain from South Africa
... Phylogenetic analysis of this sample of 66 drug-resistant strains from Panama revealed that nearly one-half of the cases of MDR-TB over the past decade have been caused by a single circu- lating strain, LAM9-c1. The ...
9
Identification of novel Imidazo[1,2 a]pyridine inhibitors targeting M tuberculosis QcrB
... against M. bovis BCG with hit confirmation in M. tuberculosis H37Rv, a number of chemical families with potential anti-tubercular value were recognized (results to be published ...
11
Association between Mycobacterium tuberculosis Beijing/W Lineage Strain Infection and Extrathoracic Tuberculosis: Insights from Epidemiologic and Clinical Characterization of the Three Principal Genetic Groups of M tuberculosis Clinical Isolates
... Mycobacterium tuberculosis can be divided into three principal genetic groups based on the single-nucleotide polymorphisms at the katG gene codon 463 and the gyrA gene codon ...of M. tuberculosis ...
6
Cmr is a redox responsive regulator of DosR that contributes to M tuberculosis virulence
... Rv3676 are global regulators that bind cAMP (22). How- ever, Cmr lacks 15 of the 17 amino acids that form the primary cAMP binding pocket of Rv3676 (23). The sec- ondary cAMP-binding site in Rv3676 (composed of Asn67, ...
14
Comparison of In house PCR with Conventional Techniques and Cobas Amplicor M tuberculosis™ Kit for Detection of Mycobacterium tuberculosis
... Mycobacterium tuberculosis by comparing PCR results with conventional diagnostic techniques and Cobas Amplicor ...M. tuberculosis TM ...Amplicor M. tuberculosis TM kit in 120 specimens ...
8
Use of real time polymerase chain reaction for detection of M tuberculosis, M avium and M kansasii from clinical specimens
... Global TB control efforts are based on rapid diagnosis of disease cases followed by adequate treatment thus prevent continued transmission. With increased inci- dence of TB and non tuberculous disease infection espe- ...
7
Comparison of Roche Cobas Amplicor Mycobacterium tuberculosis Assay with In House PCR and Culture for Detection of M tuberculosis
... Mycobacterium tuberculosis assay, which is a semiautomated version of the manually performed Roche Amplicor ...M. tuberculosis test, was compared to culture and an IS6110-based in-house PCR ...
7
Fast and Accurate Identification of M tuberculosis Complex Using an Immunochromatographic MPT64 Antigen Detection Test
... Background: A new rapid Immunochromatographic test (ICT) kit (MPT64 TB Ag Kit) for detection of MPT64 Antigen in M. tuberculosis (MTB) isolates used for rapid identification of MTB isolates developed by SD ...
8
Expression of M tuberculosis induced suppressor of cytokine signaling (SOCS) 1, SOCS3, FoxP3 and secretion of IL 6 associates with differing clinical severity of tuberculosis
... post M. tuberculosis stimulation, SOCS1 levels were lower in cases with less severe ETB as compared with more severe ETB and also as com- pared with advanced ...
9
Increased vitamin D receptor expression from macrophages after stimulation with M tuberculosis among persons who have recovered from extrapulmonary tuberculosis
... We have previously shown that persons with previous extrapulmonary TB appeared to have a subtle immune de- fect with decreased cytokine production and lower CD4 lymphocyte counts compared to persons with previous ...
9
Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions
... Authors’ response: Thanks very much for the comments. It is really nice suggestions to explain more on the BBH- LS algorithm, and that will help to increase the reader confidence of our prediction approaches. However, ...
30
PknB remains an essential and a conserved target for drug development in susceptible and MDR strains of M. Tuberculosis
... PknB has autophosphorylation properties [23], with a cross-phosphorylation potential of other STPKs such as PknA, and PknG [24]. Moreover, PknB seems to control major metabolic pathways directly via phosphorylation of ...
10
First documented cure of a suggestive exogenous reinfection in polymyositis with same but multidrug resistant M tuberculosis
... probes for devR (devRf, 5' GGTGAGGCGGGTTCGGTCGC 3'; devRr, 5' CGCGGCTTGCGTCCGACGTTC 3') and chemiluminescence detection were done according to the standard method recommended for the DNA fingerprint- ing of M. ...
5
Piggyback drug development: (Molecular docking of Entacapone analogues as direct M tuberculosis InhA inhibitors)
... The promising bioactivity of entacapone against M. tuberculosis InhA [8] stimulates the search for structurally similar compounds with antitubercular activity. Accordingly, we looked for entacapone-like ...
7
Clinical Performances of Pure TB Lamp Kit for M tuberculosis Complex Detection in Sputum Samples
... bacteria Growth Indicator Tube (MGIT), 500 µl of pellet were inoculated and incubated in MGIT 960 instrument. MPT64 antigen was detected on positive culture. Of 500 patients enrolled, 469 were included. Clinical isolates ...
10