M. tuberculosis

Top PDF M. tuberculosis:

IDENTIFICATION OF M. tuberculosis

IDENTIFICATION OF M. tuberculosis

According to the World Health Organization recommendations, it is imperative that all mycobacteria isolates be identified at least to the level of M. tuberculosis complex vs. non- tuberculous mycobacteria (NTM) and that a rapid and affordable method of species identification be used.

7 Read more

Comparative Evaluation of PCR with Commercial Multiplex M  tuberculosis Detection Kit

Comparative Evaluation of PCR with Commercial Multiplex M tuberculosis Detection Kit

On the other side, the PCR positivity was found 100% in smear positive samples by utilizing In House PCR as well as commercial multiplex M. tuberculosis PCR kit. One culture positive & smear negative sample could not detect by In house PCR. It may be due to the presence of zero copy (0-19 copies of IS6110) [24]. However, one false negative result was observed through In-house PCR. This could be explained or resulted from (a) The presence of inhibitors not detected by the control amplification; (b) Non-homogenous distribution of bacteria or that the fraction tested does not contain mycobacteria; and (c) low number of bacilli in the sample. Also, a number of studies in India have shown that, nucleotide sequence in IS6110 is not always present within strains of M. tuberculosis causing disease in India. Primers with different nucleotide sequence are now being used in India by a few laboratories to ensure that all cases are detected by PCR amplification [6,19, 21, 31].
Show more

8 Read more

A Highly Efficient Ziehl Neelsen Stain: Identifying De Novo Intracellular Mycobacterium tuberculosis and Improving Detection of Extracellular M  tuberculosis in Cerebrospinal Fluid

A Highly Efficient Ziehl Neelsen Stain: Identifying De Novo Intracellular Mycobacterium tuberculosis and Improving Detection of Extracellular M tuberculosis in Cerebrospinal Fluid

Tuberculous meningitis leads to a devastating outcome, and early diagnosis and rapid chemotherapy are vital to reduce morbid- ity and mortality. Since Mycobacterium tuberculosis is a kind of cytozoic pathogen and its numbers are very few in cerebrospinal fluid, detecting M. tuberculosis in cerebrospinal fluid from tuberculous meningitis patients is still a challenge for clinicians. Ziehl-Neelsen stain, the current feasible microbiological method for the diagnosis of tuberculosis, often needs a large amount of cerebrospinal fluid specimen but shows a low detection rate of M. tuberculosis. Here, we developed a modified Ziehl-Neelsen stain, involving cytospin slides with Triton processing, in which only 0.5 ml of cerebrospinal fluid specimens was required. This method not only improved the detection rate of extracellular M. tuberculosis significantly but also identified intracellular M. tuberculosis in the neutrophils, monocytes, and lymphocytes clearly. Thus, our modified method is more effective and sensitive than the conventional Ziehl-Neelsen stain, providing clinicians a convenient yet powerful tool for rapidly diagnosing tubercu- lous meningitis.
Show more

5 Read more

Use of Enzyme Linked Immunospot Assay with Mycobacterium tuberculosis  Specific Peptides for Diagnosis of Recent Infection with M  tuberculosis after Accidental Laboratory Exposure

Use of Enzyme Linked Immunospot Assay with Mycobacterium tuberculosis Specific Peptides for Diagnosis of Recent Infection with M tuberculosis after Accidental Laboratory Exposure

conclude definitively that responses to TB37.6 are found ex- clusively in recently infected individuals, and the observation could be coincidental. Further studies are needed to validate our findings. In both accidentally infected persons, responses to TB37.6 had become undetectable after treatment was com- pleted, but this does not necessarily imply a causal relationship between treatment and the kinetics of the immune response. Two other studies indicate that there might be a sequential appearance of antigen-specific responses after infection with M. tuberculosis (28, 29). It has been reported that ELISPOT responses to ESAT-6 and CFP-10 became negative during successful treatment of active TB, while remaining positive in those without clinical improvement (9). A prospective follow-up study of recently infected persons with or without treatment for latent TB infection may clarify the natural kinetics of T-cell re- sponses to TB37.6 and assess the effect of treatment.
Show more

5 Read more

Lack of intracellular replication of M. tuberculosis and M. bovis BCG caused by delivering bacilli to lysosomes in murine brain microvascular endothelial cells

Lack of intracellular replication of M. tuberculosis and M. bovis BCG caused by delivering bacilli to lysosomes in murine brain microvascular endothelial cells

Invasion and traversal of the blood-brain barrier (BBB) by Mycobacterium tuberculosis cause meningeal tuberculosis (TB) in the central nervous system (CNS). Meningeal TB is a serious, often fatal disease that disproportionately affects young children. The mechanisms involved in CNS invasion by M. tuberculosis bacilli are poorly understood. In this study, we microscopically examined endosomal trafficking and measured survival of M. tuberculosis and M. bovis Bacille Calmette-Guérin (BCG) bacilli in murine brain microvascular endothelial cells (BMECs). The results show that both species internalize but do not replicate in BMECs in the absence of a cytotoxic response. Confocal microscopy indicates that bacilli-containing vacuoles are associated with the early endosomal marker, Rab5, late endosomal marker, Rab7, and lysosomal marker, LAMP2, suggesting that bacilli-containing endosomes mature into endolysosomes in BMECs. Our data also show that a subset of intracellular M. tuberculosis, but not BCG bacilli, escape into the cytoplasm to avoid rapid lysosomal killing. However, the intracellular mycobacteria examined cannot spread cell-to-cell in BMECs. Taken together, these data show that with the exception of the small terminal cytoplasmic population of bacilli, M. tuberculosis does not modulate intracellular trafficking in BMECs as occurs in macrophages and lung epithelial and endothelial cells.
Show more

12 Read more

Multidrug Resistant Tuberculosis in Panama Is Driven by Clonal Expansion of a Multidrug Resistant Mycobacterium tuberculosis Strain Related to the KZN Extensively Drug Resistant M  tuberculosis Strain from South Africa

Multidrug Resistant Tuberculosis in Panama Is Driven by Clonal Expansion of a Multidrug Resistant Mycobacterium tuberculosis Strain Related to the KZN Extensively Drug Resistant M tuberculosis Strain from South Africa

Phylogenetic analysis of this sample of 66 drug-resistant strains from Panama revealed that nearly one-half of the cases of MDR-TB over the past decade have been caused by a single circu- lating strain, LAM9-c1. The LAM9-c1 strain is a member of the LAM strain family, which is prevalent in South and Central Amer- ica. The LAM9-c1 strain was identified in multiple health regions within Panama, primarily among men 25 to 64 years of age. The gender bias, which frequently is observed among TB cases, prob- ably reflects sociocultural differences, in that men are more likely than women to work and interact with wider networks of people. While there is no direct evidence that LAM9-c1 is more virulent than other strains of M. tuberculosis, it is notable that over one-half (52%) of the patients infected with this strain ultimately died. The LAM9-c1 strain bears the resistance markers RpoB(S531L), KatG(S315T), and rrs(C517T), conferring resistance to INH, RIF, and streptomycin, respectively. Each of these mutations individ- ually has among the lowest (but nonzero) fitness cost for each drug (36, 45, 46). Putative compensatory mutations in RpoC were found in only a fraction of the MDR isolates; therefore, a general molecular explanation for why these strains can tolerate the bur- den of resistance mutations remains unknown.
Show more

9 Read more

Identification of novel Imidazo[1,2 a]pyridine inhibitors targeting M  tuberculosis QcrB

Identification of novel Imidazo[1,2 a]pyridine inhibitors targeting M tuberculosis QcrB

As a result of the recently completed HTS campaign against M. bovis BCG with hit confirmation in M. tuberculosis H37Rv, a number of chemical families with potential anti-tubercular value were recognized (results to be published elsewhere). Amongst those families, we and others have identified imidazo[1,2-a]pyridines (IP) as simple chemical scaffolds amenable to further lead optimization (Figure 1) [10,23,24,25,26]. A preliminary profiling of the initial IP 1 and IP 2 (Table 1) showed how the compounds were potent and selective anti-tuberculars with no evident signs of cytotoxicity. Despite this interesting profile, the low stability observed in mouse microsomal fractions precluded their progression to the available in vivo acute murine TB efficacy model. Medicinal chemistry efforts (details to be reported elsewhere) were hence dedicated to the quick identification of an optimized compound that was able to retain anti-tubercular potency while simultaneously improving the metabolic degradation profile. These efforts led to the identifica- tion of IP 3 and 4 (Figure 1, Table 1). The improved in vitro metabolic stability found was then confirmed in a murine pharmacokinetic model (Figure 2).
Show more

11 Read more

Association between Mycobacterium tuberculosis Beijing/W Lineage Strain Infection and Extrathoracic Tuberculosis: Insights from Epidemiologic and Clinical Characterization of the Three Principal Genetic Groups of M  tuberculosis Clinical Isolates

Association between Mycobacterium tuberculosis Beijing/W Lineage Strain Infection and Extrathoracic Tuberculosis: Insights from Epidemiologic and Clinical Characterization of the Three Principal Genetic Groups of M tuberculosis Clinical Isolates

Clinical strains of Mycobacterium tuberculosis can be divided into three principal genetic groups based on the single-nucleotide polymorphisms at the katG gene codon 463 and the gyrA gene codon 95. One subgroup of genetic group 1, the Beijing/W lineage, has been widely studied because of its worldwide distribution and association with outbreaks. In order to increase our understanding of the clinical and epidemiological rele- vance of the genetic grouping of M. tuberculosis clinical strains and the Beijing/W lineage, we investigated the genetic grouping of 679 clinical isolates of M. tuberculosis, representing 96.3% of culture-confirmed tuberculosis cases diagnosed in Arkansas between January 1996 and December 2000 using PCR and DNA sequencing. We assessed the associations of infections by different genetic groups of M. tuberculosis strains and infection by the Beijing/W lineage strains with the clinical and epidemiological characteristics of the patients using chi-square tests and multivariate logistic regression analysis. Of the 679 study isolates, 676 fell into one of the three principal genetic groups, with 63 (9.3%) in group 1, 438 (64.8%) in group 2, and 175 (25.9%) in group 3. After adjusting for potential confounding of age, gender, race/ethnicity, human immunodeficiency virus serostatus, and plcD genotype in a multivariate logistic regression model, patients infected by the Beijing/W lineage isolates were nearly three times as likely as patients infected with the non-Beijing/W lineage isolates to have an extrathoracic involvement (odds ratio [95% confidence interval], 2.85 [1.33, 6.12]). Thus, the Beijing/W lineage strains may have some special biological features that facilitate the development of extrathoracic tuberculosis.
Show more

6 Read more

Cmr is a redox responsive regulator of DosR that contributes to M  tuberculosis virulence

Cmr is a redox responsive regulator of DosR that contributes to M tuberculosis virulence

Rv3676 are global regulators that bind cAMP (22). How- ever, Cmr lacks 15 of the 17 amino acids that form the primary cAMP binding pocket of Rv3676 (23). The sec- ondary cAMP-binding site in Rv3676 (composed of Asn67, Asn137, Asp140 and Gln156) is also poorly conserved in Cmr. Thus, although associated with regulation of cAMP- and macrophage-induced genes, it was concluded that Cmr was unlikely to interact with cAMP. Consistent with this view Cmr binding to several potential target promoters was unaffected by addition of cAMP (10,12). Here, Cmr binding at the groEL2 promoter region was unaffected by addition of 2 mM cAMP and partial proteolysis of Cmr in the pres- ence and absence of cAMP (and other related nucleotides: AMP, ADP, ATP, cCMP, CMP, CDP, CTP, UMP, UDP and UTP) yielded identical profiles, indicating that Cmr does not respond to cAMP or any of the other nucleotide lig- ands tested (Figure 1). Thus, although M. bovis BCG Cmr has been associated with cAMP-responsive gene regulation in vivo (10), there is no evidence in favour of direct inter- action between cAMP and M. tuberculosis Cmr (this work) or M. bovis BCG Cmr (13, unpublished data). Other mem- bers of the CRP family have been shown to utilize heme and iron-sulfur clusters as sensory co-factors (2), but the UV-visible spectrum of isolated Cmr did not indicate the presence of these co-factors, nor did Cmr specifically incor-
Show more

14 Read more

Comparison of In house PCR with Conventional Techniques and Cobas Amplicor M  tuberculosis™ Kit for Detection of Mycobacterium tuberculosis

Comparison of In house PCR with Conventional Techniques and Cobas Amplicor M tuberculosis™ Kit for Detection of Mycobacterium tuberculosis

Purpose: Polymerase chain reaction (PCR) assay, introduced as a fast and sensitive diagnostic method, is useful in detecting Mycobacterium tuberculosis. The purpose of this study was to evaluate the usefulness of in-house PCR assay in the detection of Mycobacterium tuberculosis by comparing PCR results with conventional diagnostic techniques and Cobas Amplicor M. tuberculosis TM kit. Materials and Methods: We retrospectively assessed the diagnostic yield of in-house PCR method employed for the amplification IS6110 sequences in 2,973 specimens. We also compared in-house PCR with Cobas Amplicor M. tuberculosis TM kit in 120 specimens collected
Show more

8 Read more

Use of real time polymerase chain reaction for detection of M  tuberculosis, M  avium and M  kansasii from clinical specimens

Use of real time polymerase chain reaction for detection of M tuberculosis, M avium and M kansasii from clinical specimens

Global TB control efforts are based on rapid diagnosis of disease cases followed by adequate treatment thus prevent continued transmission. With increased inci- dence of TB and non tuberculous disease infection espe- cially among HIV patients, diagnostics with better sensitivity and ability to identify M. tuberculosis and non tuberculous mycobacteria are required for appropriate management. Among the commonest non tuberculous mycobacteria affecting HIV patients include M. avium and M. kansasii which can be genomic DNA amplified and specific products identified within the same reaction using florescence monitoring by Real time PCR. The re- cently WHO endorsed Real time PCR based assay; GeneXpert® (Cepheid, Sunnyvale, USA) that offers rapid identification of MTB and rifampicin resistance but cannot identify M. avium and M. kansasii . This study aimed at assessing Mycobacterium real time PCR assay to identify M. tuberculosis, M. kansasii and M. avium from patient clinical specimens at baseline diagnosis and the data shows that Real time PCR was sensitive in identifying MTB at baseline diagnosis and had a signifi- cantly short turnaround time compared to liquid culture.
Show more

7 Read more

Comparison of Roche Cobas Amplicor Mycobacterium tuberculosis Assay with In House PCR and Culture for  Detection of M  tuberculosis

Comparison of Roche Cobas Amplicor Mycobacterium tuberculosis Assay with In House PCR and Culture for Detection of M tuberculosis

The new Roche Cobas Amplicor Mycobacterium tuberculosis assay, which is a semiautomated version of the manually performed Roche Amplicor M. tuberculosis test, was compared to culture and an IS6110-based in-house PCR protocol. A total of 1,681 specimens from 833 patients, including specimen types other than sputum, were tested in parallel by both the in-house PCR and the Cobas Amplicor M. tuberculosis assay. After we resolved discrepant PCR results, the sensitivity, specificity, and positive and negative predictive values for the Cobas Amplicor M. tuberculosis assay were 66.33, 99.71, 94.36, and 97.66%, respectively. The corresponding values for the in-house PCR were 91.08, 99.85, 97.87, and 99.37%, respectively. For culture- and smear-positive specimens, the sensitivity of the Cobas Amplicor M. tuberculosis test was 96.42% (in-house PCR, 100%). If only smear-negative sputum specimens were considered, the Cobas Amplicor M. tuberculosis assay exhibited a sensitivity of 45.45% (in-house PCR, 63.63%) relative to that of culture. With a modified protocol for DNA extraction (washing of samples plus ultrasonication), both PCR methods performed better with gastric aspirates than with sputum samples (sensitivity of the Cobas Amplicor M. tuberculosis assay with smear- negative gastric aspirates, 70.00%; sensitivity of in-house PCR, 90.00%). With dithiothreitol being used for liquefaction of specimens in this study, the Cobas Amplicor M. tuberculosis assay exhibited an inhibition rate of 9.16%. In our view, the new Cobas Amplicor M. tuberculosis test (i) is well suited for typing of smear-positive specimens, (ii) may also be applied to gastric aspirates and other types of specimens if DNA extraction methods are modified appropriately, and (iii) exhibits a sensitivity with smear-negative sputum specimens which makes it recommendable that a minimum of three samples from the same patient be tested.
Show more

7 Read more

Fast and Accurate Identification of M  tuberculosis Complex Using an Immunochromatographic MPT64 Antigen Detection Test

Fast and Accurate Identification of M tuberculosis Complex Using an Immunochromatographic MPT64 Antigen Detection Test

Background: A new rapid Immunochromatographic test (ICT) kit (MPT64 TB Ag Kit) for detection of MPT64 Antigen in M. tuberculosis (MTB) isolates used for rapid identification of MTB isolates developed by SD (Standard Diagnostics) Bio line, South Korea was evaluated. The ICT is a rapid, reliable and cheaper method that can be used instead of conventional biochemical tests for con- firming MTB in culture isolates in resource limited laboratories. The study also evaluated the abil- ity of ICT to detect MPT64-Antigen before the micro MGIT could signal positive. Material/Methods: A total of 450 sputum samples of individual patients were used for the study. 152 isolates of My- cobacteria were recovered from solid and liquid media. These strains were tested for the detec- tion of MPT64-antigen. H37Rv strain was served as the positive reference control and also used for early detection of Antigen experiment. Findings: The development of bands on both test and sample region when H37Rv strain was tested were seen (MPT64 antigen positive). When 138 MTB isolates were tested, it showed a similar banding pattern indicating 100% sensitivity. MPT64 band formation was not detected in any of the 14 isolates indicating 100% specificity. Both PPV & NPV were 100%. All the isolates negative for MPT64 Ag were confirmed as MOTT by conventional bio- chemical PNBA. The H37Rv strain showed a faint band from the 2 nd day onwards from inoculation
Show more

8 Read more

Expression of M  tuberculosis induced suppressor of cytokine signaling (SOCS) 1, SOCS3, FoxP3 and secretion of IL 6 associates with differing clinical severity of tuberculosis

Expression of M tuberculosis induced suppressor of cytokine signaling (SOCS) 1, SOCS3, FoxP3 and secretion of IL 6 associates with differing clinical severity of tuberculosis

expression observed in these patients despite a reduced lymphocyte count could be attributed to SOCS1 expres- sion from macrophages [41,42]. We previously demon- strated that an increased SOCS1 mRNA expression associates with clinical severity in PTB patients [28]. Here we show that post M. tuberculosis stimulation, SOCS1 levels were lower in cases with less severe ETB as compared with more severe ETB and also as com- pared with advanced PTB. Previous studies have shown that mycobacterial antigen specific IFN-γ levels are high- est in the L-ETB group [43] as compared with other sites. As SOCS1 impacts IFN-γ regulation [44], the reduced SOCS1 expression in less severe ETB group may indicate more effective T effector cell responses leading to protective granuloma formation in these cases. These data fit with previous studies that have shown higher IFN-γ responses in patients with pleural TB than those with miliary disease [9]. Also that in patients with tuberculous lymphadenitis IFN-γ responses are raised as compared to those with severe dissemi- nated ETB [27].
Show more

9 Read more

Increased vitamin D receptor expression from macrophages after stimulation with M  tuberculosis among persons who have recovered from extrapulmonary tuberculosis

Increased vitamin D receptor expression from macrophages after stimulation with M tuberculosis among persons who have recovered from extrapulmonary tuberculosis

We have previously shown that persons with previous extrapulmonary TB appeared to have a subtle immune de- fect with decreased cytokine production and lower CD4 lymphocyte counts compared to persons with previous pulmonary TB, persons with LTBI and uninfected con- tacts [8–10]. We also have shown that persons with previ- ous extrapulmonary TB have increased T cell activation and increased frequency of regulatory T cells compared to the other patient groups [11]. The increased expression of VDR and IL-1β in persons with previous extrapulmonary TB suggests that even after successful anti-mycobacterial therapy, their macrophages remain “primed” and demon- strate a brisk response after re-stimulation with M. tuber- culosis. Our results may indicate “trained immunity” – epigenetic modification of monocytes as a result of prior exposure to M. tuberculosis. Previous studies have noted increased production of IL-1β and TNF-α after healthy volunteers underwent BCG vaccination [48].
Show more

9 Read more

Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions

Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions

Authors’ response: Thanks very much for the comments. It is really nice suggestions to explain more on the BBH- LS algorithm, and that will help to increase the reader confidence of our prediction approaches. However, BBH- LS algorithm is actually not our algorithm. The authors of BBH-LS developed their algorithms independently with- out any involvement from us. We get to know and used this algorithm through their publications on BMC system biology “BBH-LS: an algorithm for computing positional homologs using sequence and gene context similarity” by Zhang et al. But I strongly agree that BBH-LS algorithm needs to be explained more in our work to increase reader’s confidence. Therefore we have revised the manuscript accordingly “To identify the homologs between M. tubercu- losis H37Rv and the 10 bacteria (in our stringent approach) and also the between M. tuberculosis H37Rv and H. sapi- ens (in the conventional approach), we use the BBH- LS algorithm which computes positional homologs using both sequence and gene context similarity [18]. BBH-LS is an effective and simple method to identify the positional
Show more

30 Read more

PknB remains an essential and a conserved target for drug development in susceptible and MDR strains of M. Tuberculosis

PknB remains an essential and a conserved target for drug development in susceptible and MDR strains of M. Tuberculosis

PknB has autophosphorylation properties [23], with a cross-phosphorylation potential of other STPKs such as PknA, and PknG [24]. Moreover, PknB seems to control major metabolic pathways directly via phosphorylation of multiple protein substrates, such as the protein regula- tor GarA that halts the TCA cycle [25], the KasA/B pro- teins involved in the biosynthesis of the essential mycolic acid [26], and the Wag31 proteins involved in cell divi- sion and morphology [27]. Likewise, virulence factors SigH and RshA [28], and cell wall biosynthetic enzymes GlmU or PBPA are also influenced [29, 30]. Thus, PknB is established as an important participant and a regula- tor of cell division and growth in M. tuberculosis proving its essentiality. However, there are no studies, to the best Fig. 5 Interaction of residues with the ligand. a Interaction of Methionine-155 with the ligand. b Interaction of Valine-25 with the ligand. c Interac- tion of Alanine-142 with the ligand d Interaction of Methionine-142 with the ligand
Show more

10 Read more

First documented cure of a suggestive exogenous reinfection in polymyositis with same but multidrug resistant M  tuberculosis

First documented cure of a suggestive exogenous reinfection in polymyositis with same but multidrug resistant M tuberculosis

probes for devR (devRf, 5' GGTGAGGCGGGTTCGGTCGC 3'; devRr, 5' CGCGGCTTGCGTCCGACGTTC 3') and chemiluminescence detection were done according to the standard method recommended for the DNA fingerprint- ing of M. tuberculosis [6]. Histopathologically there were nonspecific necrosis with disintegrating polymorphs, very few granulomatous cells and no epithelioid cells in the biopsy specimen. USG of kidney, liver or spleen revealed no abscess. The strain was susceptible to the 4 first line drugs [isoniazide (H), rifampicin (R), ethambutol (E) and pyrazinamide (Z)] by BACTEC 460TB system. Treatment with 4-drug regimen (H = 300 mg/d, R = 450 mg/d, E = 800 mg/d and Z = 1.5 g/d) for 8 months (2EHRZ/6HR) [7] with first 2 months supervised showed clinical improvement.
Show more

5 Read more

Piggyback drug development: (Molecular docking of Entacapone analogues as direct M  tuberculosis InhA inhibitors)

Piggyback drug development: (Molecular docking of Entacapone analogues as direct M tuberculosis InhA inhibitors)

The promising bioactivity of entacapone against M. tuberculosis InhA [8] stimulates the search for structurally similar compounds with antitubercular activity. Accordingly, we looked for entacapone-like compounds from ChemMine database and evaluated the top hits for their binding ability with the InhA target. Specifically, the entacapone analogues were docked to InhA, initially using LibDock, and the docking score for each ligand was obtained. The LibDock score is a measure of the strength of binding between a receptor and a ligand, a higher score indicates stronger binding interaction between the two [17]. Examination of the LibDock data (Table 1) revealed that the scores for compounds 1 – 4 have exceeded that of entacapone and the bound ligand, 5-pentyl-2- phenoxyphenol, signifying that these four entacapone analogues would bind with the InhA target more strongly than entacapone itself, even the native ligand.
Show more

7 Read more

Clinical Performances of Pure TB Lamp Kit for M  tuberculosis Complex Detection in Sputum Samples

Clinical Performances of Pure TB Lamp Kit for M tuberculosis Complex Detection in Sputum Samples

bacteria Growth Indicator Tube (MGIT), 500 µl of pellet were inoculated and incubated in MGIT 960 instrument. MPT64 antigen was detected on positive culture. Of 500 patients enrolled, 469 were included. Clinical isolates of M. tuberculosis Complex were detected for 157 (33.5%). Comparatively to cul- ture, Sensitivity and Specificity of SSM were 86% (95% Confidence interval (CI): 81% - 91%) 96% (95%IC: 94% - 98%) respectively. TB-Lamp Sensitivity was 92% (95%CI: 88% - 96%), and Specificity 94% (95%CI: 91% - 97%). Posi- tive Predictive Value of SSM and TB-Lamp was 91.8% and 88.8% respectively. Negative Predictive Value of TB-Lamp assay was 95.7% whereas this of SSM was 93.3%. Positive Likelihood Ratio was 15.3 for TB-Lamp and 21.5 for SSM 21.5 whereas negative Likelihood of TB-Lamp was lower than SSM. Active tuberculosis was detected in162/469 (34.5%) with TB-Lamp and 147 (31.3%) with SSM. TB-Lamp assay performances estimated from sputum samples may improve detection of active TB cases in routine.
Show more

10 Read more

Show all 10000 documents...