NF-κB/Rel
NOD2 up-regulates TLR2-mediated IL-23p19 expression via NF- κB subunit c-Rel in Paneth cell-like cells
... via NF-κB subunit c-Rel in Paneth-like ...NOD2-c- Rel axis of induction of IL-23p19 over-expression may be a better target for development of novel therapies for ...
10
CAPERα Is a Novel Rel-TAD-Interacting Factor That Inhibits Lymphocyte Transformation by the Potent Rel/NF-κB Oncoprotein v-Rel
... C-terminal Flag tag by PCR amplification with primers CTGGGATCCATG GCAGACGATATTGATATTG and ATAAGAATGCGGCCGCTATCACT TATCGTCGTCATCCTTGTAATCTCGTCTACTTGGAACCAGTAG and cloned into pcDNA3.1( ⫹ ) (Invitrogen). A CAPER ␣ mutant ...
11
NF κB/c Rel deficiency causes Parkinson’s disease like prodromal symptoms and progressive pathology in mice
... Although it remains to be determined how exactly the constitutive c-Rel deficiency can induce progressive α-synuclein accumulation and loss of dopaminergic neu- rons in SN [13], we found that c-rel -/- mice ...
20
NF κB: a key role in inflammatory diseases
... the NF- κB/Rel signaling pathway show that NF-κB plays a role in Th1-dependent delayed-type hypersensitivity responses ...(21). NF-κB activation increases expression of ...
6
NF-κB c-Rel Is Crucial for the Regulatory T Cell Immune Checkpoint in Cancer
... importance of early therapeutic intervention. RNA expression analysis demonstrated a cumulative effect of PTXF and anti-PD-1 treatments, with inflammatory cytokines and activation markers being strongly upregulated in ...
30
Key words
... of NF-κB ...of NF-κB and subsequent- ly reduce Treg ...that NF-κB (Rel A, c-Rel, NF- -κB1) acts as a positive regulator of GITR expres- sion on CD4+ and CD8+ ...
8
Control of oncogenesis and cancer therapy resistance by the transcription factor NF κB
... of NF-κB in oncogenesis is not ...c-Rel, NF-κB2 (p100/p52), and Bcl-3 proteins are located within regions of the genome that are involved in rearrangements or ...with NF- κ B2 was ...
7
IKK/NF-κB signaling contributes to glioblastoma stem cell maintenance
... NF-κB is a family of transcription factors consisting of five members: p65 (RelA), RelB, c-Rel, p105/p50, and p100/p52 that homo- and heterodimerize to regulate transcription of target genes. In the ...
15
NF κB modulated miR 130a targets TNF α in cervical cancer cells
... are NF- κ B activators, including palmitic acid, the most abundant long chain saturated fatty acid ...with NF-κB activation ...stimulating NF-κB ...stimulate NF- κ B ...
14
Immunohistochemical Expression of Nuclear Factor – Kappa B in Oral Squamous Cell Carcinoma, Oral Submucous Fibrosis and Normal Mucosa
... factor NF - κB was first discovered in 1986 by David Baltimore and Ranjan Sen as a factor in nucleus that binds the promoter of the kappa chain of immunoglobulin in B cells 12 .... NF- κB ...
80
Therapeutic potential of inhibition of the NF κB pathway in the treatment of inflammation and cancer
... of Rel/NF-κB com- ...the NF-κB pathway (1, ...the NF-κB pathway, while IKKα likely plays an accessory role ...the NF-κB proteins translocate to the nucleus, ...
9
NF κB, stem cells and breast cancer: the links get stronger
... activates NF-κB by facilitating the nuclear localization of c-REL ...in NF-κB-dependent cascades and mediate the oncogenic potential of this IKK-related ...a NF-κB ...
7
Original Article CXCR4 was involved in andrographolide inhibits atherosclerosis by inactivating the PI3K/AKT/NF-κB signaling pathway
... The results above verified andro plays a protec- tive role, the following test will investigate the related pathways of CXCR4 regulation. In this part of research, realtime-PCR and western blot were applied to detect the ...
7
Computational modelling of NF-κB activation by IL-1RI and its co-receptor TILRR, predicts a role for Cytoskeletal Sequestration of IκBα in inflammatory signalling.
... factor NF- κ B (nuclear factor kappa B) is activated by Toll-like receptors and controlled by mechanotransduction and changes in the ...of NF- κ B. Simulations used a compre- hensive agent-based model of ...
18
Gene Expression in Rat Hearts Following Oral Administration of a Single Hepatotoxic Dose of Acetaminophen
... The oxidative stress and cytokine release that occur in the infarcted heart are considered to activate NF-κB, while NF-κB activation triggers gene expression of adhesion molecules includ[r] ...
9
Original Article Ligustrazine attenuates LPS-induced endothelial dysfunction by inhibiting NF-κB pathways
... suppressing NF-κB pathway activation stim- ulated by LPS through decreasing the expres- sion and phosphorylation of p65 in NF-κB path- ...of NF-κB pathways and exact mechanisms ...
7
NF-κB/RelA-PKM2 mediates inhibition of glycolysis by fenofibrate in glioblastoma cells
... containing NF-κB/RelA- binding sites, was cloned into the luciferase reporter plasmid pGL3 (Figure ...of NF-κB/RelA enhanced the activity of luciferase construction in the presence of HIF1α, ...
10
Siegesbeckia pubescens Makino inhibits Pam3CSK4-induced inflammation in RAW 264.7 macrophages through suppressing TLR1/TLR2-mediated NF-κB activation
... of NF-κB/p65 and IκBα, but did not significantly show effect on the proteins involved in MAPKs signaling (p38, ERK and ...by NF-κB-luc reporter gene assay and p65 nuclear translocation ...
10
NF- B signaling mediates acquired resistance after PARP inhibition
... Figure 3B and 3C). Therefore, we have performed further experiments using these settings. In UWB1.289 cells, ~7.5 percent of cells have nuclear accumulation of p65 in parental cells. In contrast, ~15.2 or ~13.2 percent ...
15
Androgen receptor activity modulates responses to cisplatin treatment in bladder cancer
... In conclusion, we demonstrate preclinical evidence indicating that AR activation contributes to CDDP resistance in bladder cancer cells presumably via NF-κB activation. Therefore, patients with AR-negative ...
11