Phylogenetic analysis of the fusion gene (class-two type) sequences
Phylogenetic Analysis of Polyomavirus BK Sequences
... VP1 gene. We have used a phylogenetic whole-genome approach to examine the pattern of diversity and evolutionary relationships between 45 BKV strains isolated from multiple clinical ...This analysis ...
12
Panorama phylogenetic diversity and distribution of type A influenza viruses based on their six internal gene sequences
... epidemiological analysis is something like the iceberg on the surface, and the majority of the iceberg is underwa- ter and ...than two fifths of the viral isolates, whose sequences were selected as ...
17
Phylogenetic Analysis of Channa Species of Manipur Based on Mitochondrial Cytochrome b Gene Sequences
... Cytb gene analysis: The mitochondrial cytb gene was amplified using the primer CytBF AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA CytBR AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA The PCR amplifications were performed ...
8
Sequences and Phylogenetic Analysis of Envelope (E) Gene of Iranian Infectious Bronchitis Virus Isolates in Iran
... E gene (20). Complete genome sequence analysis of a predominant infectious bronchitis virus (IBV) strain in China has been ...in gene 3, encoding non-structural protein3a, 3b and structural protein E ...
8
A computational analysis of the phylogenetic trees of some eukaryotes sequences
... the analysis, organization, management and distribution of biological data in order to answer complex biological ...any type of a biolo system, from individual molecules to organisms to overall ...to ...
5
Phylogenetic Analysis of Some Isolates of Newcastle Disease Virus from the Sudan Using the Fusion Protein Gene
... characterization analysis. The two sets of gene specific primers used in this study (Table 1) were able to amplify fragments with the expected sizes of 984 and 1412 bp respectively from the NDV ...
99
Phylogenetic and sequence analysis of the growth hormone gene of two sturgeons, Huso huso and Acipenser Gueldenstaedtii
... With some 2900 species distributed in both Old- (1; ca. 2400 spp.) and New World (2; ca. 500 spp.), Astragalus L. is by far the largest genus of flowering plants, following by Bulbophyllum Thouars of Orchidaceae with ...
7
Phylogenetic Analysis and PCR Restriction Fragment Length Polymorphism Identification of Campylobacter Species Based on Partial groEL Gene Sequences
... PCR-RFLP analysis was found to give species-specific ...by two to three ...of two restriction enzymes may be recommended. ApoI produced two profiles only for ...RFLP analysis of the ...
9
Phylogenetic Analysis of 16S rDNA Sequences of Pediococcus acidilactici TISTR 2309:
... Three phylogenetic trees derived from the Maximum Likelihood, Neighbor-Joining and Maximum Pasimony methods, were compared in order to find the relationship of the strains constructed by each ...from ...
8
leBIBIQBPP: a set of databases and a webtool for automatic phylogenetic analysis of prokaryotic sequences
... (one type strain per species) to the loosely parsed degree (“lax” ...thousand sequences may be analyzed at a ...for phylogenetic reconstruction; iii) a speed compatible with on-line usage; and iv) ...
13
Analysis of Comparative Phylogenetic Story by Using Autosomal Markers and Mitochondrial Sequences
... country. Two chicken breeds of Chinese origin, Tam Hoang and Luong Phuong, kept in the National Institute of Animal Sciences are genetically distinct from the Vietnamese local ...
8
A Comparison and Combination of Plastid atpB and rbcL Gene Sequences for Inferring Phylogenetic Relationships within Orchidaceae
... ].-Genera from outgroup families and orchid subfamilies Apostasioideae, VaniJJoideae, Cypripedioideae, and Orchidoideae rep- resenting half of the strict consensus tree [r] ...
20
Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences
... rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan ...comprised two clades with high support values in both the ML and BI ...
9
Phylogenetic Position of North Sulawesi Tarsius sp Based on Partial Cytochrome b Gene Sequences
... b gene of North Sulawesi Tarsius ...the phylogenetic position among them, as well as several other species accessed from the ...b gene sequence amplified was 307 bp ...diversity analysis were ...
11
Keywords: Phylogenetic relationship; partial sequences of 16S mitochondrial ribosomal RNA gene; sea cucumbers
... the phylogenetic inference strongly suggested the wrong identification of ...the phylogenetic analyses failed to resolve and verify the actual taxonomic status of the six unknown species from Malaysia at ...
10
A New Type of Fusion Analysis Applicable to Many Organisms: Protein Fusions to the URA3 Gene of Yeast
... URA3 fusions offer several advantages over other systems for gene fusion analysis: the URA3 specified protein is small and cytosolic; genetic selections exist to identify m[r] ...
8
PHYLOGENETIC ANALYSIS OF 16SrDNA AND 18SrDNA SEQUENCES OF BACTERIA AND FUNGI FROM KERATITIS PATIENTS
... and Phylogenetic analysis of 16SrDNA and 18SrDNA sequences of bacteria and fungi from infectious eye sample of keratitis ...These sequences were identified using BLASTn (Basic Local Alignment ...
10
Phylogenetic Analysis of the Zingiberales Based on \u3cem\u3erbc\u3c/em\u3eL Sequences
... This document was originally published by Biodiversity Heritage Library in Annals of the Missouri Botanical Garden.. Copyright restrictions may apply.[r] ...
12
The evolution of Araliaceae : a phylogenetic analysis based on ITS sequences of nuclear ribosomal DNA
... 1970a; Eyde and Tseng 1971) regarded the pluri- carpellate ovary as primitive in Araliaceae, a find- ing that both Philipson (1970a) and Eyde and Tseng (1971) believed was well supported by patterns of floral ...
24
Phylogenetic Classification Of Bartonella Species By Comparing The Two-Component System Response Regulator Feup Sequences
... feuPQ two-component system is not clear yet, but its presence in all species of this genus indicates its importance in the adaptation process to various external ...the two-component system regulatory ...
7