RecA Protein
Conjugational Hyperrecombination Achieved by Derepressing the LexA Regulon, Altering the Properties of RecA Protein and Inactivating Mismatch Repair in Escherichia coli K-12
... and recA gene mutation (recA730) showed, respectively, ⵑ4- and 7-fold increases of ...lexA recA mutant increased FRE to ⵑ26-fold above wild-type ...another recA mutation produced as much SOS ...
12
Bacterial RecA Protein Promotes Adenoviral Recombination during In Vitro Infection
... bacterial RecA (38-kDa) protein, which is loaded onto bacterial and phage DNA by the heterotrimer RecBCD or alternate Rec ...proteins. RecA-mediated strand exchange (branch migration) occurs upon ...
16
Recombinogenic Activity of Chimeric recA Genes (Pseudomonas aeruginosa/Escherichia coli): A Search for RecA Protein Regions Responsible for This Activity
... coliRecA protein by DNA sequence analysis their ...of recA protease constitutive ...coli RecA pro- the deep helical groove of the activated RecA ...
9
RecA expression and DNA damage in mycobacteria
... tuberculosis recA gene is unusual in that it codes for a protein approximately twice the length of that found in other ...tuberculosis recA gene undergoes a novel post-translational modification to ...
216
DETECTION OF RECA GENE IN DEINOCOCCUS RADIODURANS BACTERIA BY USING THE PCR TECHNIQUEN
... the RecA protein of Deinococcus Radiodurans plays a unique role in the repair of DNA damage in this highly DNA damage resistant ...the RecA gene amplified by RecA R and RecA F see ...
11
Multiple Pathways of Duplication Formation with and Without Recombination (RecA) in Salmonella enterica
... of RecA-dependent dimers seen for other plasmids (Biek and Cohen ...without RecA) to resolve the plasmid co-integrates it produces in the course of replicative ...With RecA, a break at either IS3 ...
19
Into the life and death: RecA a WISE factor working to integrate survival and evolution in Escherichia coli
... RecA protein had been discovered as an unexpected and unanticipated cellular player for the control of ...others RecA activities commented in previous paragraphs that de- pendent critically of the ...
8
Transcription of the Mycobacterium tuberculosis recA gene
... this protein binds is different from that of ...repressor protein also undergoes autocatalytic cleavage in the same way as LexA under the action of RecA* (Winterling et a l, ...coli RecA ...
263
The N-terminal domain of Escherichia coli RecA have multiple functions in promoting homologous recombination
... or RecA-ATP binding (Figure 1A) [12]. A superimposition of RecA-RecA pairs from the active RecA- ssDNA presynaptic filament onto an inactive RecA protein filament (achieved by ...
13
The evolution of antibacterial chemotherapy : targeting RecA to sabotage antibiotic tolerance and resistance mechanisms
... The introduction and widespread use of antibiotics beginning in the World War II era led the health community to believe that humanity was rid of it’s greatest and most persistent threat, disease-causing bacteria. But ...
201
Excision and transposition of Tn5 as an SOS activity in Escherichia coli.
... T h e additional role of the activated RecA protein in enhancing transposition could quite possibly be to mediate the cleavage of another repressor or an inhibitor.[r] ...
13
Genetic Functions Promoting Homologous Recombination in Escherichia coli: A Study of Inversions in Phage Λ
... In addition to RecA protein and RecBCD enzyme, inversion by the RecBC pathway required single-stranded DNA binding protein, DNA gyrase, DNA polymerase I and DNA li[r] ...
14
Evaluation of recA Sequences for Identification of Mycobacterium Species
... the recA gene as an alternative sequencing target in order to complement 16S rRNA sequence-based genetic ...The recA genes of 30 Mycobacterium species were amplified by PCR, sequenced, and compared with the ...
7
5632.pdf
... Because RecA is ubiquitous 101 and highly conserved 102 among bacteria, but has only distant human homologs, 46,103-107 potent and selective RecA inhibitors may serve as novel chemotherapeutic adjuvants to ...
172
PCR Based Detection and Identification ofBurkholderia cepacia Complex Pathogens in Sputum from Cystic Fibrosis Patients
... A number of different methods have been described for the preparation of bacterial DNA from sputum. In particular, Campbell et al. (4) and Whitby et al. (34) described the lysis of bacterial cells in sputum by freeze ...
9
Ectopic Expression of O Antigen in Bordetella pertussis by a Novel Genomic Integration System
... (Fig. 3A) in a series of PCRs in a manner similar to those shown in Fig. 2, and LPS of the tested strains was examined for the expression of O antigen by using Tricine-SDS–PAGE followed by silver staining. B. ...
11
Transcriptional analysis of the recA gene of Streptococcus thermophilus
... a recA null mutation before and after 30 min of exposure to 20 ng/ml of mitomicin C by use of RNeasy kit ...the recA gene (A4: GGTGGAAGAAGTCGATCTGATG; A5 CCTTGCTCACCAGAATCAGGC) and for the 16S ribos- omal ...
8
The mechanism of recA polA lethality: suppression by RecA-independent recombination repair activated by the lexA(Def) mutation in Escherichia coli.
... re& is essential for the S r p pathway: The require- ment for the RecA recombinase activity in PolA mutants suggests that the Srp pathway might involve homolo- gous [r] ...
12
Agent-based Modeling and Simulation of Biomolecular Reactions
... To change the state of the switch, ultraviolet (UV) light is applied. UV light leads to a significant change in the behavior of a bacterial protein called RecA, causing it to cleave lambda Repressor ...
12
Dark rituals, magical relics
... The dimensions and objectives underpinning the Visual Arts in Practice course are: Dimensions Knowing and understanding Applying and understanding Creating and evaluating Objectives Reca[r] ...
57