[PDF] Top 20 Arabidopsis chromosome 2 sequence
Has 10000 "Arabidopsis chromosome 2 sequence" found on our website. Below are the top 20 most common "Arabidopsis chromosome 2 sequence".
Arabidopsis chromosome 2 sequence
... to sequence the first higher ...the Arabidopsis genome by ...of chromosome 2, which represents approximately 15% of the Arabidopsis ...of chromosome 4, which represents about 17% ... See full document
5
The Effect of Sequence Divergence on Recombination Between Direct Repeats in Arabidopsis
... 51341 AGCCGCTCGAGGTCCTGTAGAAACCCC of spots measured in each of the two experiments was highly 51342 GGGGTACCGCGGCCGCATTCCGATCTAGTAACAT diverse. Nevertheless, we found that the ratio between the 51343 ... See full document
10
Natural Variation in a Subtelomeric Region of Arabidopsis: Implications for the Genomic Dynamics of a Chromosome End
... in Arabidopsis and tobacco (with a genome size 20-fold greater that of Arabidopsis), the average length of deletions recovered in tobacco were relatively smaller and often accompanied by sequence ... See full document
17
The Hox-2 homeo box gene complex on mouse chromosome 11 is closely linked to Re.
... I n this paper we have bridged part of the resolution gap between the DNA sequence and the chromosome by identifying RFLP alleles for the Hox-2 locus and using them to e[r] ... See full document
9
Intron Loss and Gain During Evolution of the Catalase Gene Family in Angiosperms
... dicot, Arabidopsis thaliana, two catalase (CAT ) genes, CAT1 and CAT3, are tightly linked on chromosome 1 and a third, CAT2, which is more similar to CAT1 than to CAT3, is unlinked on chromosome ... See full document
11
Optical and physical mapping with local finishing enables megabase scale resolution of agronomically important regions in the wheat genome
... file 2: Figure S7, Additional file 13, [28]) to show that the 7AS telosome also has a localized CENH3 binding domain near the telosome ...analysis chromosome spreads shown in Additional file 2: ... See full document
18
Towards a complete sequence of the human Y chromosome
... required for spermatogenesis was mapped to the human Y chromosome [10]. The search for the testis determinant resulted in the cloning of the SRY gene in 1990 [1]. Now, more than 20 active genes or gene families ... See full document
5
Centromere Locations and Associated Chromosome Rearrangements in Arabidopsis lyrata and A. thaliana
... thaliana chromosome IV by a reciprocal translocation between ...each chromosome was probably similar to that of ...thaliana chromosome I, the centromere of A. lyrata chromosome 2 was ... See full document
7
The Maternal Chromosome Set Is the Target of the T-DNA in the in Planta Transformation of Arabidopsis thaliana
... a 2-mm bud from a WS plant, showing a representative embryo the progeny of 279 individual vacuum-infiltrated plants com- sac containing eight nuclei (n) that will migrate to form the pared to a random distribution ... See full document
13
Analysis of the myosins encoded in the recently completed Arabidopsis thaliana genome sequence
... transverse cell walls and is strongest in the newly formed cell wall. Immunogold electron microscopy showed labeling of class VIII myosin associated with the plasma membrane and plasmodesmata. These studies suggest that ... See full document
19
A Multilocus Sequence Survey in Arabidopsis thaliana Reveals a Genome-Wide Departure From a Neutral Model of DNA Sequence Polymorphism
... D and F and Fay and Wu’s H), simulations were population size). Likelihood estimates were calculated carried out by taking into account recurrent muta- by generating 100–200 coalescent trees for each set of tions at the ... See full document
16
Redefining the ancestral origins of the interleukin 1 superfamily
... and sequence similarity was used to examine the relationship of the four IL-1 family clusters to create a more realistic IL-1 ligand superfamily tree that better reflects the uncertain evolutionary history of ... See full document
12
Effect of the Major Repeat Sequence on Chromosome Loss in Candida albicans
... Candida albicans, a diploid yeast, is the most frequently isolated fungal pathogen in humans, accounting for 8% of hematogenously disseminated infections, primarily in immu- nocompromised patients (1). It is also a ... See full document
9
Reduced Sequence Variability on the NeoY Chromosome of Drosophila americana americana
... Figure 2.—Structure and analysis of the Adh gene. Sequences were obtained for an 884-bp region of the gene, from 7 bases upstream of the initiation codon to 7 bases prior to the stop codon. The three exons are ... See full document
13
The sequence of human chromosome 21 and implications for research into Down syndrome
... complete chromosome 21 and it is assumed that the DS phenotypic features are a direct consequence of the overex- pression of some number of genes contained within 21q (21p is largely made up of ribosomal RNA genes ... See full document
9
Transferability of Sorghum Genic Microsatellite Markers to Peanut
... 52% of the common ESTs (Table 3). Most of annotated SbESTs were related to basic functions of plant cells such as metabolism, photosynthesis, signal transduction, transcription, growth, and transportation across mem- ... See full document
12
The birth of a human specific neural gene by incomplete duplication and gene fusion
... of sequence to HYDIN2. Such events are rare (2/2981 or ...reciprocal sequence exchange has occurred between HYDIN paralogs on chromosomes 1 and ... See full document
16
Molecular Organization of Large Fragments in the Maize B Chromosome: Indication of a Novel Repeat
... repeat: Sequence an unknown element (Figure ...TSD sequence of mPIF and BR12-4) ...LTR sequence of a retrotransposon (Tekay) and nucleotides of the 3⬘ end of BR12-2 are identical to the so was ... See full document
16
Characterization of a Maize Chromosome 4 Centromeric Sequence: Evidence for an Evolutionary Relationship With the B Chromosome Centromere
... meric sequences hybridize to all maize A chromosomes, BAC clone analysis: The Cent4 sequence was used as albeit to varying extents (Ananiev et al. 1998). Subse- a probe to screen a BAC library of maize B73 DNA ... See full document
12
Arabidopsis and Brassica Comparative Genomics: Sequence, Structure and Gene Content in the ABI1-Rps2-Ck1 Chromosomal Segment and Related Regions
... to sequence the missing portion of this gene from a BAC clone (as explained above) to complete all 14 exons and promoter (Table ...for Arabidopsis and Brassica se- 14 are variable in size, along with most ... See full document
10
Related subjects