• No results found

[PDF] Top 20 Considerations on the use of nucleic acid based amplification for malaria parasite detection

Has 10000 "Considerations on the use of nucleic acid based amplification for malaria parasite detection" found on our website. Below are the top 20 most common "Considerations on the use of nucleic acid based amplification for malaria parasite detection".

Considerations on the use of nucleic acid based amplification for malaria parasite detection

Considerations on the use of nucleic acid based amplification for malaria parasite detection

... true parasite prevalence was made evident when protocols based on nucleic acid amplification were ...was based on a nested polymerase chain reaction (PCR) amplification of ... See full document

8

Nucleic Acid Sequence Based Amplification with Oligochromatography for Detection of Trypanosoma brucei in Clinical Samples

Nucleic Acid Sequence Based Amplification with Oligochromatography for Detection of Trypanosoma brucei in Clinical Samples

... detect parasite RNA in CSF from HAT patients and had a reproducibility of 100%, making this assay reliable and valuable for deciding the course of ...microscopic detection, 4 ml of CSF was centrifuged and ... See full document

6

Detection of Dengue Viral RNA Using a Nucleic Acid Sequence Based Amplification Assay

Detection of Dengue Viral RNA Using a Nucleic Acid Sequence Based Amplification Assay

... isothermal nucleic acid sequence-based amplification (NASBA) assay was optimized to amplify viral RNA of all four dengue virus serotypes by a set of universal primers and to type the amplified ... See full document

5

Detection of Mycoplasma pneumoniae in Spiked Clinical Samples by Nucleic Acid Sequence Based Amplification

Detection of Mycoplasma pneumoniae in Spiked Clinical Samples by Nucleic Acid Sequence Based Amplification

... Isothermal nucleic acid sequence-based amplification (NASBA) was applied to the detection of Mycoplasma ...the detection of inhibitors was ...of detection of ...the ... See full document

7

Multiplex Nucleic Acid Amplification Test for Diagnosis of Dengue Fever, Malaria, and Leptospirosis

Multiplex Nucleic Acid Amplification Test for Diagnosis of Dengue Fever, Malaria, and Leptospirosis

... the detection of DENV-1 to -4 (based on the pan- DENV assay), all species of Leptospira, and the five Plasmodium species known to be pathogenic in humans, with a specific callout for ...DENV ... See full document

8

Prevalence of Plasmodium spp  in malaria asymptomatic African migrants assessed by nucleic acid sequence based amplification

Prevalence of Plasmodium spp in malaria asymptomatic African migrants assessed by nucleic acid sequence based amplification

... The forward primer was: 5' TCAGATACCGTCGTAATCTTA 3' (nucleotides1066 to 1086); the reverse primer was: 5'- AATTCTAATACGACTCACTATAGGGAGAAGGAACTT- TCTCGCTTGCGCGAA-3' (T7 promoter sequence, linker and nucleotides 1216 to ... See full document

7

Nucleic Acid Amplification Assays for Detection of La Crosse Virus RNA

Nucleic Acid Amplification Assays for Detection of La Crosse Virus RNA

... of nucleic acid sequence-based amplification (NASBA) and quantitative real-time reverse transcription (RT)-PCR assays for the detection of La Crosse (LAC) virus in field-collected ... See full document

5

Nucleic Acid Sequence Based Amplification (Nasba)-Prospects And Applications

Nucleic Acid Sequence Based Amplification (Nasba)-Prospects And Applications

... clinical use (Rodríguez-Lázaro et ...the detection of viable microorganisms in foods, NASBA will need to be applied directly, ...to nucleic acids extracted directly from the food ...However, ... See full document

16

Detection and identification of human Plasmodium species with real time quantitative nucleic acid sequence based amplification

Detection and identification of human Plasmodium species with real time quantitative nucleic acid sequence based amplification

... Quantitative Nucleic Acid Sequence Based Amplification (real-time QT-NASBA) assays, based on the small- subunit 18S rRNA gene, to identify the four human Plasmodium ...lower ... See full document

6

Analytical Performance and Clinical Utility of a Nucleic Acid Sequence Based Amplification Assay for Detection of Cytomegalovirus Infection

Analytical Performance and Clinical Utility of a Nucleic Acid Sequence Based Amplification Assay for Detection of Cytomegalovirus Infection

... the detection of active CMV infection use either tube or shell vial cell culture (9) as a mea- sure of viremia or an immunofluorescence assay (IFA) as a test for the presence of pp65 antigen (AG-IFA) ... See full document

6

Nucleic Acid Sequence Based Amplification Assays for Rapid Detection of West Nile and St  Louis Encephalitis Viruses

Nucleic Acid Sequence Based Amplification Assays for Rapid Detection of West Nile and St Louis Encephalitis Viruses

... for nucleic acid isolation, NASBA, and ECL ...that use TaqMan assays, the NASBA-beacon assay could thus be a primary or confirmatory test by a unique amplification method with the same ... See full document

8

Evaluation of non instrumented nucleic acid amplification by loop mediated isothermal amplification (NINA LAMP) for the diagnosis of malaria in Northwest Ethiopia

Evaluation of non instrumented nucleic acid amplification by loop mediated isothermal amplification (NINA LAMP) for the diagnosis of malaria in Northwest Ethiopia

... rapid amplification, sim- ple operation and easy detection, NINA-LAMP has po- tential applications for clinical diagnosis and surveillance of malaria in developing countries including Ethiopia ... See full document

9

RNA amplification by nucleic acid sequence based amplification with an internal standard enables reliable detection of Chlamydia trachomatis in cervical scrapings and urine samples

RNA amplification by nucleic acid sequence based amplification with an internal standard enables reliable detection of Chlamydia trachomatis in cervical scrapings and urine samples

... the use of NASBA for routine diag- ...powerful amplification technique with a high sensitivity for the detection of ...The use of an internal standard for NASBA will exclude false-negative ... See full document

7

Sensitivity and Specificity of Nucleic Acid Sequence-Based Amplification Method for Diagnosis of Cutaneous Leishmaniasis

Sensitivity and Specificity of Nucleic Acid Sequence-Based Amplification Method for Diagnosis of Cutaneous Leishmaniasis

... of Nucleic Acid Sequence-Based Amplification Method for Diagnosis of Cutaneous Leishmaniasis Abstract Background and Objective : Culture, microscopic method is a gold standard method for ... See full document

7

Characterization and Multicentric Validation of a Common Standard for Toxoplasma gondii Detection Using Nucleic Acid Amplification Assays

Characterization and Multicentric Validation of a Common Standard for Toxoplasma gondii Detection Using Nucleic Acid Amplification Assays

... The molecular diagnosis of toxoplasmosis essentially relies upon laboratory-developed methods and suffers from lack of stan- dardization, hence the large diversity of performances between laboratories. Moreover, ... See full document

8

Nucleic Acid Sequence Based Amplification Assay for Human Papillomavirus mRNA Detection and Typing: Evidence for DNA Amplification

Nucleic Acid Sequence Based Amplification Assay for Human Papillomavirus mRNA Detection and Typing: Evidence for DNA Amplification

... of nucleic acid sequence-based amplification (NASBA)-based HPV detection using HPV DNA plasmids (HPV type 16 [HPV16], HPV18, HPV31, HPV33, and HPV45) and nucleic ... See full document

6

Rapid Enterovirus RNA Detection in Clinical Specimens by Using Nucleic Acid Sequence Based Amplification

Rapid Enterovirus RNA Detection in Clinical Specimens by Using Nucleic Acid Sequence Based Amplification

... failed amplification, since NASBA was invalid on initial testing for 18%, and on final testing for 9%, of ...of amplification by NASBA was most troublesome for throat and NP samples, which resulted in ... See full document

5

Molecular detection and identification of enteroviruses using enzymatic amplification and nucleic acid hybridization

Molecular detection and identification of enteroviruses using enzymatic amplification and nucleic acid hybridization

... We synthesized cDNA from the RNA genomes of five CVB3 isolates, as well as from four other enteroviruses, using B3-1 as the primer, and then amplified the cDNA using both B3-1 and B3-2 p[r] ... See full document

8

Individual Donor Nucleic Acid Amplification Testing for Detection of West Nile Virus

Individual Donor Nucleic Acid Amplification Testing for Detection of West Nile Virus

... The nucleic acid amplification test (NAT) for WNV RNA in donated blood was implemented in June/July 2003 under an Investigational New Drug exemption issued by the FDA to two ... See full document

6

Use of Nucleic Acid Amplification Testing for Diagnosis of Extragenital Sexually Transmitted Infections

Use of Nucleic Acid Amplification Testing for Diagnosis of Extragenital Sexually Transmitted Infections

... The study showed good agreement between the two NAAT systems for urine samples from men, but the Xpert had a high number of false-negative vaginal swab results for C. trachomatis. Nevertheless, 5 of the 8 women who had ... See full document

7

Show all 10000 documents...