• No results found

[PDF] Top 20 Expression of intermediate filaments (IF) in tissues and cultured cells

Has 10000 "Expression of intermediate filaments (IF) in tissues and cultured cells" found on our website. Below are the top 20 most common "Expression of intermediate filaments (IF) in tissues and cultured cells".

Expression of intermediate filaments (IF) in tissues and cultured cells

Expression of intermediate filaments (IF) in tissues and cultured cells

... Int J DCL Biul n 55 tol (t989) 55 Expression of intermediate filaments (IF) in tissues and cultured cells ISMO VIRTANEW, KRISTIINA HEIKINHEIMO, MARKETTA HORMIA, TERO KIVELA LlISA lAITINEN and lARS ERI[.] ... See full document

7

Expression of Intermediate Filament Nestin in Blood Vessels of Neural and Non-neural Tissues

Expression of Intermediate Filament Nestin in Blood Vessels of Neural and Non-neural Tissues

... endothelial cells was well ...endothelial cells that contained this proliferative marker in their nuclei ...postmitotic cultured cells were published by Sahlgren et ...stin expression ... See full document

7

Functional expression of NF1 tumor suppressor protein: association with keratin intermediate filaments during the early development of human epidermis

Functional expression of NF1 tumor suppressor protein: association with keratin intermediate filaments during the early development of human epidermis

... as cells of malignant peripheral nerve sheath tumors of neurofibromatosis patients may display loss of heterozygosity of the NF1 gene ...astrocytoma tissues of otherwise healthy persons ... See full document

11

History and phylogeny of intermediate filaments: Now in insects

History and phylogeny of intermediate filaments: Now in insects

... in cells obtained from chicken muscle in addition to the well established actin and myosin filaments, highly abundant in ...new filaments was determined to be intermediate between that of ... See full document

5

Molecular manipulation of keratin 8/18 intermediate filaments: modulators of FAS-mediated death signaling in human ovarian granulosa tumor cells

Molecular manipulation of keratin 8/18 intermediate filaments: modulators of FAS-mediated death signaling in human ovarian granulosa tumor cells

... keratin intermediate filaments is to provide stability and morphological integ- rity to cells, yet in recent years a more dynamic role has ...keratin filaments are heterotetra- mers of two ... See full document

11

Beta, Beta'-Iminodipropionitrile-Induce Movement of Vimentin Intermediate Filaments to the Perinuclear Region is Insufficient to Inhibit cPLA2 Activity.

Beta, Beta'-Iminodipropionitrile-Induce Movement of Vimentin Intermediate Filaments to the Perinuclear Region is Insufficient to Inhibit cPLA2 Activity.

... Adenovirus infection causes a rapid and strong innate immune reaction, with accompanying inflammation. While most adenovirus infections cause mild symptoms, and can be cleared within 10 days, infections with serotypes 4 ... See full document

46

Dysfunctions of neuronal and glial intermediate filaments in disease

Dysfunctions of neuronal and glial intermediate filaments in disease

... in expression of a truncated NFL protein that contained only a portion of the head domain ...transfected cells. Further studies in cultured motor neu- rons showed that the coexpression of wild-type  ... See full document

12

Introducing intermediate filaments: from discovery to disease

Introducing intermediate filaments: from discovery to disease

... However, during the past 2 decades, knowledge regarding the functions of these structures has been expanding rapidly. Many disease-related roles of IFs have been revealed. In some cases, the molecular mechanisms ... See full document

10

Cultured human amniotic fluid cells characterized with antibodies against intermediate filaments in indirect immunofluorescence microscopy

Cultured human amniotic fluid cells characterized with antibodies against intermediate filaments in indirect immunofluorescence microscopy

... epithelial cells as indicated by the positive keratin-fluorescence in ...keratin-positive cells could be ...epithelial cells, previously called amniotic fluid cells ...These cells ... See full document

9

Intermediate filaments in malignant melanomas  Identification and use as marker in surgical pathology

Intermediate filaments in malignant melanomas Identification and use as marker in surgical pathology

... Intermediate-sized filaments have been studied in human malignant melanomas and in normal melanocytes by immunofluorescence microscopy with antibodies directed against keratin, vimentin, desmin, ... See full document

10

Interaction of Theiler’s Virus with Intermediate Filaments of Infected Cells

Interaction of Theiler’s Virus with Intermediate Filaments of Infected Cells

... 2D gel electrophoresis and microsequencing. Cultured cells were washed twice in phosphate-buffered saline (PBS). They were lysed by incubation for 3 min at 100°C in a solution containing 50 mM Tris HCl (pH ... See full document

8

Nutrients Modulate T1r2 Transcript Levels in MIN 6 and Primary Cultured Taste Buds Cells under High Glucose Condition

Nutrients Modulate T1r2 Transcript Levels in MIN 6 and Primary Cultured Taste Buds Cells under High Glucose Condition

... T1r2 expression, we preliminary tested 5-aminoimidazole-4-carboxamide 1-β-D-ribonucleoside (AICAR; putative AMPK ...T1r2 expression. In Hep G2 cells, resveratrol (1 - 5 μM) was reported to sti- ... See full document

8

XB130 promotes proliferation and invasion of gastric cancer cells

XB130 promotes proliferation and invasion of gastric cancer cells

... cancer cells and altered the EMT-like associated proteins by cultured ...transfected cells was much lower and the cells were round spheroids with no or few ...3 cells in each group ... See full document

11

Differentiation of RPE cells from integration-free iPS cells and their cell biological characterization

Differentiation of RPE cells from integration-free iPS cells and their cell biological characterization

... iPSC-RPE cells and ROSs that have been internalized, as described pre- viously [23, ...Finally, cells were washed with DPBS-CM before the membranes of the Transwell inserts were excised and mounted onto mi- ... See full document

17

Self consistent field theory for the interactions between keratin intermediate filaments

Self consistent field theory for the interactions between keratin intermediate filaments

... We have applied the SCF approach to study interactions of the unstructured N and C terminal domains of skin ker- atin (K1/K10) Intermediate Filaments. Positively charged N and C domains were grafted onto ... See full document

17

Endothelial cell annexins and oxidative stress

Endothelial cell annexins and oxidative stress

... of expression of numerous genes in many different cell ...endothelial cells ICAM-1 and VCAM-1 have been reported to become elevated (Wiliam et ...of expression of this ...carcinoma cells ... See full document

181

Effects of edible bird's nest (EBN) on cultured rabbit corneal keratocytes

Effects of edible bird's nest (EBN) on cultured rabbit corneal keratocytes

... Total RNA Extraction and Gene Expression Analyses Total RNA from cultured keratocytes in A) Serum-con- taining medium, FDS, B) FDS plus 0.05% EBN, C) Serum- free medium, FD and D) FD plus 0.05% EBN were ... See full document

10

The Centrioles, Centrosomes, Basal Bodies, and Cilia of Drosophila melanogaster

The Centrioles, Centrosomes, Basal Bodies, and Cilia of Drosophila melanogaster

... nurse cells of the egg chamber begin their endoreduplication cycles, the cen- trioles migrate to accumulate at the oocyte before ultimately being eliminated so that female meiosis can occur on a centriole-free ... See full document

21

Original Article The effect of miRNA-210 on the biological behavior ovarian carcinoma A2780 cells

Original Article The effect of miRNA-210 on the biological behavior ovarian carcinoma A2780 cells

... Total RNA was extracted from ovarian cancer tissues and was reverse-transcribed into cDNA. The upstream primer sequence of miR-210 was CTGTGCGTGTGACAGCGGCTGA and the down- stream primer was a general primer ... See full document

9

Original Article MiRNA-495 inhibits cell proliferation and invasion abilities in gastric cancer cells by down-regulation of FGFRL1

Original Article MiRNA-495 inhibits cell proliferation and invasion abilities in gastric cancer cells by down-regulation of FGFRL1

... GC tissues and cells as indicated by RT-qPCR ...GC cells, and the Transwell chamber assay suggested that miRNA-495 inhibited the metastatic and invasion abilities of the GC ...skeletal ... See full document

11

Show all 10000 documents...