[PDF] Top 20 Insertion/Deletion Gene Polymorphism and Serum Level of Angiotensin Converting Enzyme
Has 10000 "Insertion/Deletion Gene Polymorphism and Serum Level of Angiotensin Converting Enzyme" found on our website. Below are the top 20 most common "Insertion/Deletion Gene Polymorphism and Serum Level of Angiotensin Converting Enzyme".
Insertion/Deletion Gene Polymorphism and Serum Level of Angiotensin Converting Enzyme
... of insertion allele, the genotype of the subjects could be classified as II (homozygote for the insertion allele), DD (homozygote for deletion allele), or ID ... See full document
5
Original Article Association between angiotensin-converting enzyme gene insertion/deletion polymorphism and osteoarthritis: a meta-analysis
... with serum level and activity of ...ACE level is two-fold high- er in the DD genotype carriers than that in gen- otype II ...Kallikrein level in synovial fluid and kinin B2 receptor expression ... See full document
12
Association of Angiotensin-I-Converting Enzyme (ACE) Insertion/Deletion Gene Polymorphism with End Stage Renal Disease in Egyptian Patients
... proteolyitic enzyme that is produced in the juxtaglomerular cells of ...decapeptide, angiotensin I (Ang I) [5]. Angiotensin-I-converting enzyme (ACE) gene is one of the most ... See full document
9
Insertion/Deletion Polymorphisms and Serum Angiotensin-converting Enzyme Levels in Iranian Patients with Sarcoidosis
... ACE gene polymor- phism, serum ACE levels and its relationship to sarcoidosis with appropriate sample ...This level also in DD and ID genotypes showed sig- nificant differences between patients and ... See full document
8
Judo status is not associated with the angiotensin-converting enzyme insertion/deletion polymorphism in Japanese judo athletes
... the angiotensin- converting enzyme (ACE) gene has been extensively studied for its association with endurance [4, ...ACE insertion/deletion (I/D) polymorphism was first ... See full document
7
Association of Angiotensin Converting Enzyme Gene Insertion/Deletion Polymorphism with Coronary Artery Disease in South Indian Population.
... vasoconstrictory angiotensin 2 and endothelin1. Increased production of angiotensin 2 also activates free radical injury to endothelium and decreases the availability of ... See full document
82
Lack of significant association of an insertion/deletion polymorphism in the angiotensin converting enzyme (ACE) gene with tropical calcific pancreatitis
... for angiotensin converting enzyme (ACE) inhibitors in reducing pancreatic fibrosis in experimental ...ACE gene insertion/deletion (I/D) polymorphism in TCP patients using ... See full document
7
Frequency of Alu insertions within the ACE and PR loci in Northwestern Mexicans
... The insertion/deletion (I/D) polymorphism of the angi- otensin-converting enzyme (ACE) locus is an important genetic biomarker that has served in numerous geno- type–phenotype ... See full document
5
The relationship of the factor V Leiden mutation or the deletion deletion polymorphism of the angiotensin converting enzyme to postoperative thromboembolic events following total joint arthroplasty
... V gene that includes nucleotide 1691 was amplified utilizing the polymerase chain reaction (PCR) with the forward prim- er 5'CATACTACAGTGACGTGGAC3' and the reverse primer ... See full document
6
Association between the angiotensin-converting enzyme gene insertion/deletion polymorphism and susceptibility to systemic lupus erythematosus in an Indian population.
... controls, serum prepared and stored at -80°C until required. Enzyme-linked immunosorbent assay (ELISA) kits for measuring serum ACE levels in patient and control sera were purchased from Bio ... See full document
17
Does the Angiotensin converting enzyme (ACE) gene insertion/deletion polymorphism modify the response to ACE inhibitor therapy? – A systematic review
... I/D polymorphism has received much attention since its discovery, and many pharmacogenetic studies have been conducted in different patient groups to assess its effect ...ACE gene insertion/ ... See full document
12
Original Article Association of angiotensin-converting enzyme insertion/deletion polymorphism with panic disorder risk: a meta-analysis
... I/D polymorphism and panic disor- der risk; (c) studies sharing the same sample of cases and controls were compared and the most complete study from them was included in our ... See full document
8
Lack of Association between ACE I/D and AGTR1 A1166C Gene Polymorphisms and Preeclampsia in Turkish Pregnant Women of Trakya Region
... of Angiotensin Converting Enzyme Insertion/Deletion (ACE I/D) and the distribution of Angiotensin II Type 1 Receptor A1166C (AGTR1 A1166C) gene polymorphisms in ... See full document
5
Original Article Angiotensin-converting enzyme gene insertion/deletion polymorphism is associated with increased risk of arthritis: a meta-analysis
... ACE gene I/D polymorphism with susceptibility to ...ACE gene I/D variant genotype to an increased risk of ...ACE gene I/D polymorphism ... See full document
9
Angiotensin Converting Enzyme Gene Insertion(I) / Deletion(D) Polymorphism and its association with Type 2 Diabetics with Nephropathy.
... that angiotensin II stimulates neovascularisation by promoting arteriolar smooth muscle cell proliferation, and this has led to increased interest in the role that angiotensin II may play a role in ... See full document
137
Relationship Between Angiotensin-Converting Enzyme Gene Insertion or Deletion Polymorphism and Insulin Sensitivity in Healthy Newborns
... Recruits to this study were born at term or near term after a normal pregnancy, had normal acid-base status at birth, no history of maternal hypertension, and were breastfed during the study. The data were, therefore, ... See full document
8
Angiotensin-converting enzyme gene insertion/deletion polymorphism in migraine patients
... There was no difference in ACE genotype distribution between a migraine and a control population in our mate- rial. Our study also indicates that ACE genotyping will not be a valuable tool for predicting clinical ... See full document
5
Angiotensin converting enzyme as a genetic risk factor for coronary artery spasm Implication in the pathogenesis of myocardial infarction
... an insertion/deletion (I/D) polymorphism of the angiotensin converting enzyme (ACE) gene are at greater risk for myocardial infarction (MI), especially among subjects ... See full document
6
Angiotensin-converting enzyme genotype and late respiratory complications of mustard gas exposure
... Renin Angiotensin System (RAS) has been implicated in lung inflammatory and fibrotic ...the gene coding for the Angiotensin Converting Enzyme (ACE), specifically the ... See full document
5
An insertion/deletion polymorphism in the angiotensin I converting enzyme gene accounting for half the variance of serum enzyme levels
... in serum ACE levels was observed between subjects in each of the three ACE genotype ...classes. Serum immunoreactive ACE concentrations were, respectively, ... See full document
5
Related subjects