• No results found

[PDF] Top 20 Brd2/RING3 Interacts with a Chromatin-Binding Domain in the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 (LANA-1) That Is Required for Multiple Functions of LANA-1

Has 10000 "Brd2/RING3 Interacts with a Chromatin-Binding Domain in the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 (LANA-1) That Is Required for Multiple Functions of LANA-1" found on our website. Below are the top 20 most common "Brd2/RING3 Interacts with a Chromatin-Binding Domain in the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 (LANA-1) That Is Required for Multiple Functions of LANA-1".

Brd2/RING3 Interacts with a Chromatin-Binding Domain in the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 (LANA-1) That Is Required for Multiple Functions of LANA-1

Brd2/RING3 Interacts with a Chromatin-Binding Domain in the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 (LANA-1) That Is Required for Multiple Functions of LANA-1

... human BRD2/RING3 (801 aa) was generated by PCR from the plasmid template BRD2/RING3 pcDNA3 9E10 (46) with primers RING3-GFPC1-FOR (ACT AGATCTCTGCAAAACGTGACTCCCCAC) and ... See full document

12

Kaposi's Sarcoma-Associated Herpesvirus LANA-1 Interacts with the Short Variant of BRD4 and Releases Cells from a BRD4- and BRD2/RING3-Induced G1 Cell Cycle
Arrest

Kaposi's Sarcoma-Associated Herpesvirus LANA-1 Interacts with the Short Variant of BRD4 and Releases Cells from a BRD4- and BRD2/RING3-Induced G1 Cell Cycle Arrest

... second LANA-1 binding site in BRD2/RING3 has previously been demonstrated by our group ...C-terminal domain of LANA-1 to be indispensable for the interaction with ... See full document

15

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Interacts with Multifunctional Angiogenin To Utilize Its Antiapoptotic Functions

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Interacts with Multifunctional Angiogenin To Utilize Its Antiapoptotic Functions

... Kaposi’s sarcoma-associated herpesvirus (KSHV) is etiologically associated with the angioproliferative Kaposi’s sarcoma ...of latency-associated nuclear ... See full document

18

Regulation of the Interaction between Glycogen Synthase Kinase 3 and the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen

Regulation of the Interaction between Glycogen Synthase Kinase 3 and the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen

... Kaposi’s sarcoma-associated herpesvirus (KSHV)-encoded latency-associated nuclear antigen (LANA) protein stabilizes ␤ -catenin by the novel mechanism of ... See full document

13

DNA Binding and Modulation of Gene Expression by the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus

DNA Binding and Modulation of Gene Expression by the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus

... have multiple functions vital to viral la- ...with LANA-specific antibodies (9). We and others have shown that LANA modulates cellular gene expression positively and negatively and also ... See full document

11

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Interacts with Bromodomain Protein Brd4 on Host Mitotic Chromosomes

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Interacts with Bromodomain Protein Brd4 on Host Mitotic Chromosomes

... of LANA has been previously shown to inter- act with the ET domain of RING3/Brd2 in an insect cell lysate ...although RING3/Brd2 was primarily localized to the euchromatin and ... See full document

11

Close but Distinct Regions of Human Herpesvirus 8 Latency-Associated Nuclear Antigen 1 Are Responsible for Nuclear Targeting and Binding to Human Mitotic Chromosomes

Close but Distinct Regions of Human Herpesvirus 8 Latency-Associated Nuclear Antigen 1 Are Responsible for Nuclear Targeting and Binding to Human Mitotic Chromosomes

... Human herpesvirus 8 is associated with all forms of Kaposi’s sarcoma, AIDS-associated body cavity-based lymphomas, and some forms of multicentric Castleman’s ...disease. Herpesvirus 8, ... See full document

12

Ribosomal Protein S6 Interacts with the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus

Ribosomal Protein S6 Interacts with the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus

... of LANA to bind its cognate DNA as a biochemical assay to verify the RPS6-LANA ...a LANA promoter-luciferase construct as the ...the LANA DNA binding domain and cog- nate cis ... See full document

11

Kaposi's Sarcoma-Associated Herpesvirus-Encoded LANA Interacts with Host KAP1 To Facilitate Establishment of Viral Latency

Kaposi's Sarcoma-Associated Herpesvirus-Encoded LANA Interacts with Host KAP1 To Facilitate Establishment of Viral Latency

... Kaposi’s sarcoma-associated herpesvirus (KSHV) typically displays two different phases in its life cycle, the default latent phase and the lytic ...the latency-associated nu- clear ... See full document

14

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen: Replicating and Shielding Viral DNA during Viral Persistence

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen: Replicating and Shielding Viral DNA during Viral Persistence

... of LANA speckles to mitotic chromatin (the CBS described above) (29, 39, ...N-terminal domain of LANA was also shown to play a role in replication and transcriptional regulation (29, 74, 75) ... See full document

10

The Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus Supports Latent DNA Replication in Dividing Cells

The Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus Supports Latent DNA Replication in Dividing Cells

... that LANA plays a role in supporting the DNA replication of plasmids containing a single copy of the viral TR and that LANA binding to sequences within the TR is abso- lutely required for this ... See full document

11

Protein Interactions Targeting the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus to Cell Chromosomes

Protein Interactions Targeting the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus to Cell Chromosomes

... EBV nuclear antigen 1 (EBNA1), which is constitutively expressed in EBV-infected latent cells, binds the EBV genome, and is required for episo- mal maintenance (23, ...55). LANA can ... See full document

9

Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Latency-Associated Nuclear Antigen Regulates the KSHV Epigenome by Association with the Histone Demethylase KDM3A

Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Latency-Associated Nuclear Antigen Regulates the KSHV Epigenome by Association with the Histone Demethylase KDM3A

... aposi’s sarcoma-associated herpesvirus (KSHV), also desig- nated human herpesvirus 8 (HHV-8), has been linked to Ka- posi’s sarcoma (KS) as well as primary effusion lymphoma (PEL) (or ... See full document

12

Latency-Associated Nuclear Antigen (LANA) of Kaposi's Sarcoma-Associated Herpesvirus Interacts with Origin Recognition Complexes at the LANA Binding Sequence within the Terminal Repeats

Latency-Associated Nuclear Antigen (LANA) of Kaposi's Sarcoma-Associated Herpesvirus Interacts with Origin Recognition Complexes at the LANA Binding Sequence within the Terminal Repeats

... Kaposi’s sarcoma-associated herpesvirus (KSHV) DNA persists in latently infected cells as an episome via tethering to the host ...The latency-associated nuclear antigen ... See full document

14

Tissue Specificity of the Kaposi's Sarcoma-Associated Herpesvirus Latent Nuclear Antigen (LANA/orf73) Promoter in Transgenic Mice

Tissue Specificity of the Kaposi's Sarcoma-Associated Herpesvirus Latent Nuclear Antigen (LANA/orf73) Promoter in Transgenic Mice

... cells associated with the blood vessels (heart and muscle) upon closer ...elements required for the endothelial-cell activity of LANAp are not present in the transgene or that TABLE ... See full document

9

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Induces Expression of the Helix-Loop-Helix Protein Id-1 in Human Endothelial Cells

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Induces Expression of the Helix-Loop-Helix Protein Id-1 in Human Endothelial Cells

... Infection of ECs with KSHV induces Id-1 expression. To determine whether KSHV infection was responsible for ele- vated Id protein expression in KS, normal human microvascu- lar ECs were infected with KSHV using ... See full document

10

Complex Alternative Cytoplasmic Protein Isoforms of the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 Generated through Noncanonical Translation Initiation

Complex Alternative Cytoplasmic Protein Isoforms of the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 Generated through Noncanonical Translation Initiation

... (Table 1). The four in-frame methionines at amino acid positions 1, 6, 161, and 282 in the N-terminal domain were substituted with alanines by overlapping PCR using the indicated primer pairs (see ... See full document

12

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 Mimics Epstein-Barr Virus EBNA1 Immune Evasion through Central Repeat Domain Effects on Protein Processing

Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 Mimics Epstein-Barr Virus EBNA1 Immune Evasion through Central Repeat Domain Effects on Protein Processing

... Increasing evidence suggests that a second mechanism in- volving rapid protein degradation immediately after initial peptide synthesis may be the primary CTL epitope generation mechanism. Up to 20% of all newly made ... See full document

11

Kaposi sarcoma–associated herpesvirus: immunobiology, oncogenesis, and therapy

Kaposi sarcoma–associated herpesvirus: immunobiology, oncogenesis, and therapy

... of LANA dots correlates with the number of KSHV plas- mids in an infected ...mitosis, LANA, and by inference KSHV plasmids, decorates condensed chromosomes, thereby facil- itating proper and equal ... See full document

12

The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen.

The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen.

... The characteristic Western blot pattern of LNA is a doublet of approximately 226- to 234-kDa in HBL-6 or BC-1 cells and a slightly lower molecular mass (approximately 220- to 230- kDa) in BCP-1 cells. This ... See full document

7

Show all 10000 documents...