[PDF] Top 20 Involvement of Human CRM1 (Exportin 1) in the Export and Multimerization of the Rex Protein of Human T-Cell Leukemia Virus Type 1
Has 10000 "Involvement of Human CRM1 (Exportin 1) in the Export and Multimerization of the Rex Protein of Human T-Cell Leukemia Virus Type 1" found on our website. Below are the top 20 most common "Involvement of Human CRM1 (Exportin 1) in the Export and Multimerization of the Rex Protein of Human T-Cell Leukemia Virus Type 1".
Involvement of Human CRM1 (Exportin 1) in the Export and Multimerization of the Rex Protein of Human T-Cell Leukemia Virus Type 1
... The Rex protein of human T-cell leukemia virus type 1 acts posttranscriptionally to induce the cytoplasmic expression of incompletely spliced or unspliced ... See full document
6
Nuclear Export and Expression of Human T-Cell Leukemia Virus Type 1 tax/rex mRNA Are RxRE/Rex Dependent
... that Rex-mediated nucleocy- toplasmic export of viral RNA requires binding to human chro- mosomal region maintenance 1 (hCRM1; also known as exportin 1 [XPO1]) (18), a member of the ... See full document
7
Multimer Formation Is Not Essential for Nuclear Export of Human T-Cell Leukemia Virus Type 1 Rextrans-Activator Protein
... that Rex, like Rev, acts primarily at the level of nuclear ...nuclear export ca- pacity of biologically inactive Rex mutants in this study ...nuclear export activity is not sufficient for ... See full document
10
Rat CRM1 Is Responsible for the Poor Activity of Human T-Cell Leukemia Virus Type 1 Rex Protein in Rat Cells
... and human CRM1 proteins can export Rex to the ...help Rex export RxRE-bearing mRNA, we wondered whether rCRM1 was even able to export the Rex protein ...of ... See full document
11
Enhanced Replication of Human T-Cell Leukemia Virus Type 1 in T Cells from Transgenic Rats Expressing Human CRM1 That Is Regulated in a Natural Manner
... Human T-cell leukemia virus type 1 (HTLV-1) is the etiologic agent of adult T-cell leukemia ...the human CRM1 (hCRM1) gene, which ... See full document
11
Inhibition of Human Immunodeficiency Virus Rev and Human T-Cell Leukemia Virus Rex Function, but Not Mason-Pfizer Monkey Virus Constitutive Transport Element Activity, by a Mutant Human Nucleoporin Targeted to Crm1
... a protein complex to- gether with a third nucleoporin, termed Nup88 ...of Crm1 to bind to the nuclear pore complex by competing with authentic nucleoporins for binding to ...nuclear export but not ... See full document
9
Human T-Cell Leukemia Virus Type 1 Expressing Nonoverlapping Tax and Rex Genes Replicates and Immortalizes Primary Human T Lymphocytes but Fails To Replicate and Persist In Vivo
... and Rex are two regulatory proteins that are essential for HTLV replication ...or Rex mutants with defective activities or impaired biochemical properties that are associated with protein ...with ... See full document
9
Human T-Cell Leukemia Virus Type 1 Tax Protein Abrogates Interleukin-2 Dependence in a Mouse T-Cell Line
... HTLV-1-transformed T-cell lines in the ab- sence of IL-2. Two types of T-cell lines are transformed by HTLV-1; one is IL-2 dependent, and the other is IL-2 inde- ...the ... See full document
7
Inhibition of human T-cell leukemia virus type 2 Rex function by truncated forms of Rex encoded in alternatively spliced mRNAs.
... the Rex/RXRE regulatory pathway of HTLV, the HIV-1 Rev protein activates the expression of unspliced and singly spliced HIV-1 mRNAs through interaction with an RNA target termed the ... See full document
9
High-resolution mapping of the human T-cell leukemia virus type 1 Rex-binding element by in vitro selection.
... As a specific example, a chemically synthesized template for bulge-right (9.3 mM final concentration; 59 GGGCAATTGCTCAGGAAGAGCATGCTCCCT TGGAGCAATTGAATT 39) and its primer (94 mM final concentration; 59 AAT TCAATTGCTCCAAG ... See full document
11
Dominant-negative mutants are clustered in a domain of the human T-cell leukemia virus type I Rex protein: implications for trans dominance.
... To test whether the Rex domain located between amino acids 58 and 65 might be involved in multimerization, we constructed chimeric Rex-Rev proteins by inserting the putative Rev multimer[r] ... See full document
6
Human T-cell leukemia virus (HTLV) type II Rex protein binds specifically to RNA sequences of the HTLV long terminal repeat but poorly to the human immunodeficiency virus type 1 Rev-responsive element.
... 5 0022-538X/91/052261-12$02.00/0 Copyright C 1991, American Society for Microbiology Human T-Cell Leukemia Virus HTLV Type II Rex Protein Binds Specifically to RNA Sequences of the HTLV [r] ... See full document
12
Role of Tax protein in human T cell leukemia virus type I leukemogenicity
... nuclear export signal (NES) ...[25-27]. Rex, on the other hand, acts to promote the export of the unspliced and singly spliced viral RNAs spe- cies from the nucleus to the cytoplasm [28] by binding ... See full document
24
Site-Specific Phosphorylation Regulates Human T-Cell Leukemia Virus Type 2 Rex Function In Vivo
... HTLV Rex is a positive trans-acting regulator of viral rep- lication. Rex is a nuclear-localizing and shuttling phosphopro- tein that acts posttranscriptionally by binding and selectively exporting the ... See full document
10
Phosphorylation of Two Serine Residues Regulates Human T-Cell Leukemia Virus Type 2 Rex Function
... HTLV Rex protein or the func- tionally analogous HIV Rev ...Rev protein to enter rapidly into an efficient RNA binding state ...HTLV-1 Rex phosphorylation have revealed three phos- ... See full document
10
Effects of chimeric mutants of human immunodeficiency virus type 1 Rev and human T-cell leukemia virus type I Rex on nucleolar targeting signals.
... To estimate the function of chimeric Rev-Rex protein, two reporter plasmids were used: pBennCATRRE 13, which contains the HIV-1 long termi- Human immunodeficiency virus HIV and human T-c[r] ... See full document
5
Phosphorylation regulates human T cell leukemia virus type 1 Rex function
... and Rex are expressed from the same mRNA in partially overlapping reading frames, a point mutation was made in the nucleotide sequence that added a stop codon in the tax-1 reading frame that left the ... See full document
11
The human T-cell leukemia virus type 1 Rex regulatory protein exhibits an impaired functionality in human lymphoblastoid Jurkat T cells.
... C91PL T cells (Fig. 4A). In addition, a Western blot analysis showed that Rex was detected predominantly in the nucleus of JK-Cl11 cells ...the Rex dysfunction is not due to an impaired ...lane ... See full document
8
Human T-Cell Leukemia Virus Type 2 Rex Carboxy Terminus Is an Inhibitory/Stability Domain That Regulates Rex Functional Activity and Viral Replication
... active Rex-2 mutants, A157D and S158Term, led to increased pro- duction of p19 Gag as measured in the culture supernatant, ultimately increasing HTLV-2 infectious spread and HTLV-2- mediated cellular proliferation ... See full document
12
Transdominant repressors for human T-cell leukemia virus type I rex and human immunodeficiency virus type 1 rev function.
... The rex genes encoded by the mutant clones pLHRexM2, pLHRexM7, and pLHRexM8 were able to inhibit wild-type function of the HIV-1 Rev protein Fig.. The expression of Rev was Mnonitored by[r] ... See full document
8
Related subjects