[PDF] Top 20 Multiple Functions within the Epstein-Barr Virus EBNA-3A Protein
Has 10000 "Multiple Functions within the Epstein-Barr Virus EBNA-3A Protein" found on our website. Below are the top 20 most common "Multiple Functions within the Epstein-Barr Virus EBNA-3A Protein".
Multiple Functions within the Epstein-Barr Virus EBNA-3A Protein
... to EBNA-2 and to EBNA- 3A, -3B, and -3C. The binding of EBNA-2 to RBP-Jk has been well characterized and shown to be important in the role of EBNA-2 in EBV ...to EBNA-2 and to ... See full document
8
Truncated Form of the Epstein-Barr Virus Protein EBNA-LP Protects against Caspase-Dependent Apoptosis by Inhibiting Protein Phosphatase 2A
... of EBNA-LP might be involved in this resistance. EBNA-LP is variable in size, even when not trun- cated, and its location, in the nucleus or cytoplasm, depends on the number of W1W2 ...the EBNA-LP ... See full document
10
Interaction of Epstein-Barr Virus Nuclear Antigen Leader Protein (EBNA-LP) with HS1-Associated Protein X-1: Implication of Cytoplasmic Function of EBNA-LP
... recombinant EBNA-LP mutant viruses show much less efficiency in the phenotype (2, ...of EBNA-LP consists of the multiple-repeat domain encoded by the repeating W1 and W2 exons in the major internal ... See full document
8
Functions of the Epstein-Barr Virus EBNA1 Protein in Viral Reactivation and Lytic Infection
... EBNA1 inhibits spontaneous reactivation but is required for NaB-TPA-induced EBV reactivation in NPC cells. We next in- vestigated whether the contributions of EBNA1 that we identified in lytic reactivation in AGS-EBV are ... See full document
13
A Genome-Wide Epstein-Barr Virus Polyadenylation Map and Its Antisense RNA to EBNA
... containing multiple colinear ...of multiple polycistronic RNA transcripts commonly observed in all herpesviruses (25) and papillomaviruses (66, ...of multiple polycistronic RNA transcripts, we chose ... See full document
22
Identification of Major Phosphorylation Sites of Epstein-Barr Virus Nuclear Antigen Leader Protein (EBNA-LP): Ability of EBNA-LP To Induce Latent Membrane Protein 1 Cooperatively with EBNA-2 Is Regulated by Phosphorylation
... Epstein-Barr virus (EBV) nuclear antigen leader protein (EBNA-LP) is a phosphoprotein suggested to play important roles in EBV-induced immortalization of B ...potential functions ... See full document
10
Epstein-Barr Virus: Environmental Trigger of Multiple Sclerosis?
... to virus-encoded nucleocapsid antigens (VCA) and the IgG responses to the EBV latent antigen EBNA2 peak during acute infection, are against latent and lytic antigens (18, ...envelope protein, gp350, do not ... See full document
8
Nuclear-Cytoplasmic Shuttling Is Not Required for the Epstein-Barr Virus EBNA-LP Transcriptional Coactivation Function
... of EBNA-LP gene transcripts. Transcription of the EBNA-LP gene initiates from either the W promoter (Wp) or the C promoter ...of multiple EBNA-LP protein ...for EBNA-LP/EBNA2 ... See full document
8
Monoclonal and polyclonal antibodies against Epstein-Barr virus nuclear antigen 5 (EBNA-5) detect multiple protein species in Burkitt's lymphoma and lymphoblastoid cell lines.
... 3870-3878 0022-538X/87/123870-09$02.00/0 Copyright C 1987, American Society for Microbiology Monoclonal and Polyclonal Antibodies against Epstein-Barr Virus Nuclear Antigen 5 EBNA-5 Dete[r] ... See full document
9
Epstein-Barr virus leader protein enhances EBNA-2-mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain.
... particular EBNA-3C, upon EBNA-2 activity (29, 33, 55) would not come into ...the EBNA-3 proteins does not abrogate the activity of EBNA-LP in this type of assay, because EBNA-LP/ ... See full document
10
Interferon-independent and -induced regulation of Epstein-Barr virus EBNA-1 gene transcription in Burkitt lymphoma.
... Epstein-Barr virus (EBV) establishes a latent infection of B lymphocytes that is sustained for the life of its human ...host. Within latently infected B cells as many as nine viral proteins ... See full document
11
Cell cycle stage-specific phosphorylation of the Epstein-Barr virus immortalization protein EBNA-LP.
... of EBNA-LP on Rb and p53 functions have failed to show any significant consequences of EBNA-LP expression (2, ...and EBNA-LP proteins coalesce in the nucleolar region of the nucleus ... See full document
9
Dominant-negative inhibitors of EBNA-1 of Epstein-Barr virus.
... Epstein-Barr virus (EBV) usually maintains its genome as a plasmid in cells that it ...one protein, EBV nuclear antigen 1 (EBNA-1), to its plasmid replication (26, 36, 48); the host ... See full document
10
Epstein-Barr Virus SM Protein Functions as an Alternative Splicing Factor
... SM protein bound directly to STAT1 mRNA, we performed an in vitro RNA cross-linking assay by incubating cell extracts containing SM protein with radioactively labeled STAT1 transcript consisting of exons ... See full document
9
Multiple Epstein-Barr Virus Infections in Healthy Individuals
... mutations within restriction en- zyme cleavage sites or variations of large repetitive regions within genome fragments (19, 23, 35; Lung and Chang, ...in EBNA proteins (“EBNotype” or “EBNAprint”) ... See full document
5
Posttranslational processing of an Epstein-Barr virus-encoded membrane protein expressed in cells transformed by Epstein-Barr virus.
... However, for the following reasons we presume they represent proteolytic degradation products generated in vivo: i immunoprecipitates of COS cells electroporated with pSV2CAT a plasmid s[r] ... See full document
10
Epstein-Barr virus DNA. X. Direct repeat within the internal direct repeat of Epstein-Barr virus DNA.
... EcoRI, which makes two nucleotide sequence, CCAGGCCAGCCGGA- cuts at the left end of BamHI-C, separates US GGGACCCCGGCAGCCCGGGCG, occurs as a components of BamHI-C from the right end of d[r] ... See full document
7
Distinction between Epstein-Barr virus type A (EBNA 2A) and type B (EBNA 2B) isolates extends to the EBNA 3 family of nuclear proteins.
... Conversely, selected human sera from donors naturally infected with type B strains of EBV identified the EBNA 3a encoded by both types of isolates plus two novel EBNAs present only in ty[r] ... See full document
9
Repression of Epstein-Barr Virus EBNA-1 Gene Transcription by pRb during Restricted Latency
... of EBNA-1 in the maintenance (if not replication) of the EBV genome dictates that EBNA-1 be expressed in a proliferating cell (3), why would there be a need to repress EBNA-1 in a resting B cell? ... See full document
9
EBNA size polymorphism can be used to trace Epstein-Barr virus spread within families.
... * 4703 Downloaded from http://jvi.asm.org/ on November 10, 2019 by guest The Epstein-Barr virus EBV-determined nuclear antigens EBNA 1, 2, 3, 4, and 6, regularly expressed in EBV-transfo[r] ... See full document
6
Related subjects