[PDF] Top 20 Multiple Functions within the Epstein-Barr Virus EBNA-3A Protein

... to EBNA-2 and to EBNA- 3A, -3B, and -3C. The binding of EBNA-2 to RBP-Jk has been well characterized and shown to be important in the role of EBNA-2 in EBV ...to EBNA-2 and to ... See full document

... of EBNA-LP might be involved in this resistance. EBNA-LP is variable in size, even when not trun- cated, and its location, in the nucleus or cytoplasm, depends on the number of W1W2 ...the EBNA-LP ... See full document

... recombinant EBNA-LP mutant viruses show much less efficiency in the phenotype (2, ...of EBNA-LP consists of the multiple-repeat domain encoded by the repeating W1 and W2 exons in the major internal ... See full document

... EBNA1 inhibits spontaneous reactivation but is required for NaB-TPA-induced EBV reactivation in NPC cells. We next in- vestigated whether the contributions of EBNA1 that we identified in lytic reactivation in AGS-EBV are ... See full document

... containing multiple colinear ...of multiple polycistronic RNA transcripts commonly observed in all herpesviruses (25) and papillomaviruses (66, ...of multiple polycistronic RNA transcripts, we chose ... See full document

... Epstein-Barr virus (EBV) nuclear antigen leader protein (EBNA-LP) is a phosphoprotein suggested to play important roles in EBV-induced immortalization of B ...potential functions ... See full document

... to virus-encoded nucleocapsid antigens (VCA) and the IgG responses to the EBV latent antigen EBNA2 peak during acute infection, are against latent and lytic antigens (18, ...envelope protein, gp350, do not ... See full document

... of EBNA-LP gene transcripts. Transcription of the EBNA-LP gene initiates from either the W promoter (Wp) or the C promoter ...of multiple EBNA-LP protein ...for EBNA-LP/EBNA2 ... See full document

... 3870-3878 0022-538X/87/123870-09$02.00/0 Copyright C 1987, American Society for Microbiology Monoclonal and Polyclonal Antibodies against Epstein-Barr Virus Nuclear Antigen 5 EBNA-5 Dete[r] ... See full document

... particular EBNA-3C, upon EBNA-2 activity (29, 33, 55) would not come into ...the EBNA-3 proteins does not abrogate the activity of EBNA-LP in this type of assay, because EBNA-LP/ ... See full document

... Epstein-Barr virus (EBV) establishes a latent infection of B lymphocytes that is sustained for the life of its human ...host. Within latently infected B cells as many as nine viral proteins ... See full document

... of EBNA-LP on Rb and p53 functions have failed to show any significant consequences of EBNA-LP expression (2, ...and EBNA-LP proteins coalesce in the nucleolar region of the nucleus ... See full document

... Epstein-Barr virus (EBV) usually maintains its genome as a plasmid in cells that it ...one protein, EBV nuclear antigen 1 (EBNA-1), to its plasmid replication (26, 36, 48); the host ... See full document

... SM protein bound directly to STAT1 mRNA, we performed an in vitro RNA cross-linking assay by incubating cell extracts containing SM protein with radioactively labeled STAT1 transcript consisting of exons ... See full document

... mutations within restriction en- zyme cleavage sites or variations of large repetitive regions within genome fragments (19, 23, 35; Lung and Chang, ...in EBNA proteins (“EBNotype” or “EBNAprint”) ... See full document

... However, for the following reasons we presume they represent proteolytic degradation products generated in vivo: i immunoprecipitates of COS cells electroporated with pSV2CAT a plasmid s[r] ... See full document

... EcoRI, which makes two nucleotide sequence, CCAGGCCAGCCGGA- cuts at the left end of BamHI-C, separates US GGGACCCCGGCAGCCCGGGCG, occurs as a components of BamHI-C from the right end of d[r] ... See full document

... Conversely, selected human sera from donors naturally infected with type B strains of EBV identified the EBNA 3a encoded by both types of isolates plus two novel EBNAs present only in ty[r] ... See full document

... of EBNA-1 in the maintenance (if not replication) of the EBV genome dictates that EBNA-1 be expressed in a proliferating cell (3), why would there be a need to repress EBNA-1 in a resting B cell? ... See full document

... * 4703 Downloaded from http://jvi.asm.org/ on November 10, 2019 by guest The Epstein-Barr virus EBV-determined nuclear antigens EBNA 1, 2, 3, 4, and 6, regularly expressed in EBV-transfo[r] ... See full document