[PDF] Top 20 Structural analyses of the Epstein-Barr virus BamHI A transcripts.

... simplex virus type 1 (HSV-1) ICP4 (IE175) protein consisting of 38% homology (20% identical and 18% similar residues) over a region of 178 codons ...the BamHI A ORFs by using the Genetics Computer Group ... See full document

... Analysis of 5 ⴕ termini of BARTs. BARTs are a family of alternatively spliced transcripts that are 3 ⬘ coterminal (25, 47, 53). Two potential 5 ⬘ termini have been identified by RT-PCR and cDNA isolation (47, 52, ... See full document

... The question of BamHI-A transcription in BL cells required analysis of recently established BL cell lines which retain the latency I form of infection characteristic of the tumor itself [r] ... See full document

... latent transcripts similar to those seen in wild-type LCLs and E2RE-deleted LCLs ...EBV transcripts on a per-cell ...abundant transcripts in this LCL panel were EBNA2 (median, 87 transcripts ... See full document

... Given the large overlap between the genes downregulated by EBV infection and BART lncRNA expression, the function of the BART lncRNA in downregulating specific cellular genes was con- firmed by qRT-PCR in six AGS-EBV ... See full document

... of BamHI- and DpnI- resistant full-length DNA (right) to BamHI (2 cut sites)-digested DNA ...with BamHI (single cut site) (left) or with both BamHI and ...input BamHI-digested DNA ... See full document

... and BamHI sites, ...and BamHI, and ligated between the NdeI and BamHI sites in pET15b ...a BamHI site at the C terminus of the amplified ...and BamHI and cloned between the NdeI and ... See full document

... That is, the major EBV polyadenylated RNA species were found to be transcribed from a region of the viral genome BamHI-A which had not previously been identified as transcriptionally act[r] ... See full document

... To characterize transcripts that are encoded in this region, polyA+ RNA from the EBV-transformed lymphoblastoid cell line JY was isolated, and this RNA was used to generate a cDNA librar[r] ... See full document

... the BamHI A region were originally identified in NPC, where they are abundantly expressed (4, 7, 16, 17, ...Sequence analyses of clones obtained from a cDNA library of tumor xenograft C15 revealed that the ... See full document

... A DMS reaction, analyzed with primer ic complementary to EBER1 nucleotides 149 through 167; B kethoxal reaction, analyzed with primer lb complementary to EBER1 nucleotides 89 through 107[r] ... See full document

... relatives in the other human herpesviruses (9, 10, 13, 16, 27, 28). This additional component appears to be important for infection of B lymphocytes but not for infection of epithelial cells (16). Perhaps reflecting its ... See full document

... However, for the following reasons we presume they represent proteolytic degradation products generated in vivo: i immunoprecipitates of COS cells electroporated with pSV2CAT a plasmid s[r] ... See full document

... Our data indicate that: i EBV penetration into target cells is blocked by ConA and high sucrose concentration 0.25 M at a trypsinsensitive stage on the cell surface; ii lower concentrati[r] ... See full document

... The discoveries that integration sites occasionally co-localize with regions containing cancer associated genes JAK2 , PD-L1 and PD-L2 in gastric carcinomas and BACH2 , REL [r] ... See full document

... (22). In these cells, we observed expression of the BARF1 gene localized in the BamHI A fragment of the viral genome (23). The BARF1 gene, encoding a 31-kDa early protein, has been shown to be able to induce ... See full document

... EcoRI, which makes two nucleotide sequence, CCAGGCCAGCCGGA- cuts at the left end of BamHI-C, separates US GGGACCCCGGCAGCCCGGGCG, occurs as a components of BamHI-C from the right end of d[r] ... See full document

... In this investigation, we have addressed the question of whether methylation of specific regulatory sequences in the EBV genome influences the expression of the EBNAs by studying the met[r] ... See full document

... Adsorption of FITC-EBV and unlabeled EBV with SV-treated cells EBNA induction" in BJA-B cells by residual EBV' % EBNA positive Residual FITC-EBVa binding EBV adsorption with: to Raji cel[r] ... See full document

... mRNA transcripts containing imperfect an- nealing sequences in their 3 ⬘ untranslated regions (3 ⬘ UTRs) and less frequently through other regions of the transcript (26, 27, ... See full document