[PDF] Top 20 Towards subunit specific proteasome inhibitors
Has 10000 "Towards subunit specific proteasome inhibitors" found on our website. Below are the top 20 most common "Towards subunit specific proteasome inhibitors".
Towards subunit specific proteasome inhibitors
... finding proteasome inhibitors with unique characteristics and focuses on subunit ...of proteasome inhibitors has been provided, detailing both those found in nature and several ... See full document
162
The resistance mechanisms of proteasome inhibitor bortezomib
... α7-subunit-specific proteasome inhibitor (5- amino-8-hydroxyquinoline, 5-HAQ) ...irreversible proteasome inhibitor carfilzomib showed only a 3–4 fold decrease in cytotoxic potential in the ... See full document
9
The testis specific proteasome subunit Prosα6T of D melanogaster is required for individualization and nuclear maturation during spermatogenesis
... Plasmid constructions and generation of transgenic flies The construction of the Pros ␣ 6T-GFP reporter gene and generation of transgenic flies were previously described by Ma et al. (Ma et al., 2002). For the ... See full document
9
Proteasome inhibitors as experimental therapeutics of autoimmune diseases
... errant proteasome activation established dysregulation of β1i proteasome subunit expression in B lymphocytes of SS patients, conferring diminished PI inhibition and resist- ance to ...(β5) ... See full document
10
The use of proteasome inhibitors in anti-cancer therapy
... 26S proteasome, thanks to its prior labeling with a poly-ubiquitin ...ubiquitin- proteasome complex is involved in the control of many important cellular ...activities. Specific proteasome ... See full document
5
Synthetic Analogs of Green Tea Polyphenols as Proteasome Inhibitors
... identical proteasome-inhibitory prop- erties and therefore only the commercial ( )-GCG was used in the experiments presented in this ...20S proteasome (Methanosarcina thermophile, Recombinant, ...(the ... See full document
11
Therapeutic targeting of cancer cell cycle using proteasome inhibitors
... regulatory subunit at both ends ...stage specific manner ...regulatory subunit of the prote- asome and the tagged protein is degraded in a ATP de- pendent manner ...with proteasome inhibition ... See full document
10
Flavokawain B targets protein neddylation for enhancing the anti-prostate cancer effect of Bortezomib via Skp2 degradation
... regulatory subunit 1(Cks1b) have been linked to Bortezomib resistance in multiple mye- loma ...a proteasome-dependent and ubiquitin-mediated degradation of Skp2 and that the effect of FKB on Skp2 ... See full document
13
Budding of Equine Infectious Anemia Virus Is Insensitive to Proteasome Inhibitors
... to proteasome inhibitors ...antibodies specific for Ub ...to proteasome inhibitors is Gag specific and maps to a region within p9 Gag ... See full document
7
Selective inhibitors of the osteoblast proteasome stimulate bone formation in vivo and in vitro
... The proteasome is a 700-kDa, cylinder-shaped, mul- ticatalytic protease complex composed of 28 subunits organized into four ...the proteasome (33). Proteasome inhibitors are of multi- ple ... See full document
13
Additive loss of function proteasome subunit mutations in CANDLE/PRAAS patients promote type I IFN production
... respective proteasome subunits that are ...absolutely proteasome specific; however, the in-gel assays confirmed the localization of the proteolytic activities to the proteasome ...the ... See full document
17
Molecular identification and characterization of Trichinella spiralis proteasome subunit beta type 7
... and specific primers carrying BamHI and HindIII restriction enzyme sites (Forward, 5′-CATG GATCCATGGAAGACGCTATTATATCATCTG-3′; Re- verse, 5′-CATAA GCTTTCATTCCATCATTTTAGTGC TTGAAAC-3′) were ... See full document
9
Duplicated Proteasome Subunit Genes in Drosophila melanogaster Encoding Testes-Specific Isoforms
... Biochemical and molecular analyses of mammalian proteasomes suggest that their subunit compositions are similar to those of yeast, with each proteasome being comprised of [r] ... See full document
11
Rapid Evolution Through Gene Duplication and Subfunctionalization of the Testes-Specific α4 Proteasome Subunits in Drosophila
... ␣4 subunit is suggestive of a more specialized mon across most taxa, as a study including bacteria, function that could have involved the loss of functional archae, and eukaryotes found that ratios of nonsynony- ... See full document
12
<p>Bortezomib sensitivity is tissue dependent and high expression of the 20S proteasome precludes good response in malignant pleural mesothelioma</p>
... and subunit expres- sion were ...low proteasome activity (PSMB2 and PSMB5) responded to 50 nM and 100 nM bortezomib better than to cisplatin (MRC-5, ...high proteasome expression, which predicts ... See full document
10
The Ubiquitin-Proteasome System Facilitates the Transfer of Murine Coronavirus from Endosome to Cytoplasm during Virus Entry
... Next, we monitored the fate of the internalized virus parti- cles in the endosomes. Endosomes from the infected cells were purified by use of a sucrose flotation gradient (6), and the viruses were traced by reverse ... See full document
5
Original Article Identification of proteasome subunit alpha type-1 as a novel biomarker in HBV-associated hepatocellular carcinoma tissue interstitial fluid by proteomic analysis
... Abstract: Differentially expressed proteins between HCC TIF and normal interstitial fluid of adjacent nontumor tis- sues were identified through comparative proteomics approach. Then, two-dimensional gel electrophoresis ... See full document
9
Comparative proteomic profiling of refractory/relapsed multiple myeloma reveals biomarkers involved in resistance to bortezomib-based therapy
... the proteasome, including regulatory (PSME1, PSME2, PSMD1 and PSMD11) and catalytic components (PSMB2 and ...constitutive proteasome and with slightly changes 20S, known as the i20S complex constitute ... See full document
11
Towards an epitope-specific vaccine: Epitope-loss mutants of the human chorionic gonadotropin beta subunit
... 155 specific mAbs show low cross-reactivity with porcine LHI5 vrifich differs from hCG15 at residue 74 by having Pro (Berger et a l, ...hCG15 subunit, then the other mutations may be causing shght ... See full document
206
Continued 26S proteasome dysfunction in mouse brain cortical neurons impairs autophagy and the Keap1 Nrf2 oxidative defence pathway
... 26S proteasome dysfunction. We demonstrate short-term (early) 26S proteasome dysfunction induces selective autophagy, but long-term (continued) dysfunction decreases autophagy characterised by ... See full document
12
Related subjects