• No results found

Cellular Protein Modification by Poliovirus: the Two Faces of Poly(rC)-Binding Protein

N/A
N/A
Protected

Academic year: 2019

Share "Cellular Protein Modification by Poliovirus: the Two Faces of Poly(rC)-Binding Protein"

Copied!
14
0
0

Loading.... (view fulltext now)

Full text

(1)

0022-538X/07/$08.00⫹0 doi:10.1128/JVI.01013-07

Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Cellular Protein Modification by Poliovirus: the Two Faces of

Poly(rC)-Binding Protein

Rushika Perera,† Sarah Daijogo, Brandon L. Walter,‡ Joseph H. C. Nguyen, and Bert L. Semler*

Department of Microbiology and Molecular Genetics, School of Medicine, University of California, Irvine, California 92697-4025

Received 9 May 2007/Accepted 12 June 2007

During picornavirus infection, several cellular proteins are cleaved by virus-encoded proteinases. Such cleavage events are likely to be involved in the changing dynamics during the intracellular viral life cycle, from viral translation to host shutoff to RNA replication to virion assembly. For example, it has been proposed that there is an active switch from poliovirus translation to RNA replication mediated by changes in RNA-binding protein affinities. This switch could be a mechanism for controlling template selection for translation and negative-strand viral RNA synthesis, two processes that use the same positive-strand RNA as a template but proceed in opposing directions. The cellular protein poly(rC)-binding protein (PCBP) was identified as a primary candidate for regulating such a mechanism. Among the four different isoforms of PCBP in mammalian cells, PCBP2 is required for translation initiation on picornavirus genomes with type I internal ribosome entry site elements and also for RNA replication. Through its three K-homologous (KH) domains, PCPB2 forms functional protein-protein and RNA-protein complexes with components of the viral translation and replica-tion machinery. We have found that the isoforms PCBP1 and -2 are cleaved during the mid-to-late phase of poliovirus infection. On the basis of in vitro cleavage assays, we determined that this cleavage event was mediated by the viral proteinases 3C/3CD. The primary cleavage occurs in the linker between the KH2 and KH3 domains, resulting in truncated PCBP2 lacking the KH3 domain. This cleaved protein, termed

PCBP2-⌬KH3, is unable to function in translation but maintains its activity in viral RNA replication. We propose that through the loss of the KH3 domain, and therefore loss of its ability to function in translation, PCBP2 can mediate the switch from viral translation to RNA replication.

The dynamic interplay between virus and host components is an important aspect of viral pathogenesis. Although the pri-mary antiviral host response attempts to disrupt the advance of viral infection, many viruses have developed intricate mecha-nisms to alter the intracellular milieu to achieve a replicative advantage over host cells. Picornaviruses have evolved several remarkable activities to achieve this level of replication. It has been known for many years that picornaviruses cause signifi-cant morphological and biochemical changes within infected cells. Many of these changes are driven by the functions of the nonstructural proteins and are related to the need for these viruses to maintain a balance between apoptosis and cell sur-vival for the benefit of replication (12). For instance, a cellular autophagy-like phenomenon induced by viral proteins 2BC and 3A generates large membranous vesicles that function as sites of viral RNA replication (9, 66). Rearrangement of the cytoskeletal network during a poliovirus infection has also been observed (42). The depolymerization of microtubules that occurs during this process is attributed to viral proteinase 3C-mediated cleavage of MAP-4, a microtubule-organizing protein (35, 36). Picornavirus infections also disrupt nucleocy-toplasmic trafficking, resulting in the relocalization of cellular

RNA-binding proteins to the cytoplasm, where they may be sequestered into membrane-bound viral RNA replication com-plexes (7, 8, 21, 31, 32, 43, 57). Many of these proteins are normally involved in RNA processing, transport, and stability, or they are components of the translation apparatus of the cell. However, upon infection by picornaviruses they are diverted from their cellular functions to carry out similar or different functions in the virus life cycle. The power to use host proteins differentially stems from the ability of virus-encoded protein-ases 2A, 3C, and 3CD to modify some of these host proteins, a process that also assists in host translational and transcrip-tional shutoff (14, 15, 20, 22, 26, 37, 40, 44, 59, 60, 72–74).

A significant example of molecular scavenging by picornavi-ruses is the ability of poliovirus to use poly(rC)-binding protein (PCBP) in both translation and replication of the viral genome (10, 11, 28–30, 53, 69). PCBP (also known as hnRNP E and

␣CP) is a cellular RNA-binding protein that forms two types of ribonucleoprotein (RNP) complexes in the cell. By binding to the 3⬘ noncoding region (NCR) of cellular mRNAs, it is in-volved in either the stabilization of␣/␤-globin (13, 34, 38, 70, 71), ␣(I)-collagen (45, 65), tyrosine hydroxylase (56), and erythropoietin mRNAs (19) or the translational control of mRNAs such as 15-lipoxygenase (50) and c-myc(27). PCBP is also known to bind DNA (39, 47). Four isoforms of the protein are expressed in the cell, with PCBP1 and PCBP2 being widely expressed in both the nucleus and the cytoplasm of human and mouse tissues (41) and PCBP3 and PCBP4 being expressed in low abundance (46). These proteins bind RNA through hnRNP K-homologous domains (KH domains) that have an

␣␤␣␣␤␤␣fold and specificity for polypyrimidine tracts on tar-get RNAs (63). The atomic structures of two of the KH

do-* Corresponding author. Mailing address: Department of Microbi-ology and Molecular Genetics, School of Medicine, Med Sci B240, University of California, Irvine, CA 92697. Phone: (949) 824-7573. Fax: (949) 824-2694. E-mail: [email protected].

† Present address: Department of Biological Sciences, Purdue Uni-versity, West Lafayette, IN 47907.

‡ Present address: Rocky Mountain Laboratories, Hamilton, MT 59840.

Published ahead of print on 20 June 2007.

8919

on November 8, 2019 by guest

http://jvi.asm.org/

(2)

98% amino acid sequence identity and are not only involved in binding nucleic acid but also mediate protein-protein interac-tions within the RNP complexes (46, 67).

As noted above, poliovirus requires PCBP2 for both trans-lation and replication of the viral genome (11, 28, 29, 53, 69). It has been shown that for cap-independent translation of poliovirus RNA, PCBP2 forms an RNP complex by specifically binding to stem-loop IV of the internal ribosome entry site (IRES). This binding is mediated by KH1, which is the primary RNA-binding domain (62, 69). A truncated form of PCBP2 missing the KH1 domain cannot rescue poliovirus translation in HeLa cell cytoplasmic extracts depleted of endogenous PCBP (6). The second domain (KH2) is responsible for mul-timerization of PCBP2, and this mulmul-timerization is required for RNA binding and translation initiation on the poliovirus IRES element (6). Through mutational analysis, it was deter-mined that the KH3 domain is also important for binding of PCBP2 to stem-loop IV (69). Recently, it was reported that the KH3 domain interacts with a cellular protein (SRp20) involved in cellular mRNA splicing and nucleocytoplasmic trafficking (5). Since SRp20 is also known to cofractionate with ribosome subunits (58), it was proposed that the interaction of KH3 with SRp20 might function to recruit ribosomes to the viral RNA template for translation initiation. Indeed, when the interac-tion of KH3 with SRp20 was prevented by antibody-mediated inhibition or RNA interference in transfected HeLa cells, translation via the poliovirus IRES was inhibited (5).

In addition to its role in translation, viral genomic RNA functions as the template for negative-strand RNA synthesis. However, it has been shown that viral genomes that are being actively translated cannot function as templates for RNA syn-thesis (3, 29). Viral genomes that have not been translated cannot function as templates for RNA synthesis (17, 49). Therefore, a mechanism may exist to down regulate the trans-lation of genomic RNA templates (once sufficient levels of viral proteins have been produced) and to use them as tem-plates for RNA synthesis. Evidence for a switch from transla-tion-competent templates to replicatransla-tion-competent templates has been previously published (3, 29). In a report by Gamarnik and Andino (29), it was proposed that differential binding of PCBP2 to stem-loop structures in the genomic 5⬘NCR might be involved in this process during a poliovirus infection. The splicing factor polypyrimidine tract-binding protein (PTB) has also been suggested as a candidate (2) to mediate a switch from translation to RNA replication on the basis of the observation

resulting cleavage fragments were redistributed from the nu-cleus (the predominant site of PTB function) to the cytoplasm, and recombinant forms of these PTB cleavage fragments in-hibited poliovirus translation. Therefore, translation inhibition was proposed as a mechanism for the PTB-driven switch from translation to replication of the viral genome (2).

During picornavirus RNA synthesis, PCBP1 and/or PCBP2 bind to stem-loop I of the 5⬘NCR of genomic RNA and form a ternary complex with the viral protein 3CD (1, 28, 53). This ternary complex functions with the viral RNA-dependent RNA polymerase (3Dpol) and other viral proteins to initiate protein-primed viral RNA synthesis, perhaps via protein-protein bridg-ing of the 5⬘and 3⬘termini (4, 33, 55; for a review, see refer-ence 54). It was previously reported that the binding of 3CD to stem-loop I could mediate a change in the affinity of PCBP2 binding to the poliovirus 5⬘NCR, shifting its occupancy from stem-loop IV (required for translation initiation) to stem-loop I (required for RNA synthesis) (29). This change in the affinity of PCBP2 was proposed to down regulate translation and clear the genomic RNA of ribosomes so that the RNA would be free to function as the template for negative-strand RNA synthesis. Alternatively, on the basis of the observation that picornavi-ruses alter the intracellular environment by viral proteinase-mediated modification of several cellular proteins (Table 1), it seemed an attractive hypothesis that the molecular switch from translation to replication was a result of similar proteolytic modifications of PCBP2.

In this study, we provide direct evidence that PCBP2 is cleaved during poliovirus infection of HeLa cells. We found that cleavage of PCBP2 is mediated by viral proteinases 3C and 3CD. We identified several putative 3C/3CD-specific cleavage sites within the coding region of PCBP2 and demonstrated that a site in the linker region between the KH2 domain and the KH3 domain is preferentially cleaved during the course of infection. A recombinant version of this truncated form of PCBP2 (PCBP2-⌬KH3) was unable to bind the stem-loop IV 5⬘NCR sequences required for initiation of translation but was still able to mediate the ternary complex formation with stem-loop I that is required for RNA replication. By depletion and reconstitution experiments with HeLa cell cytoplasmic ex-tracts, we have also shown that all three KH domains are required for the translation of poliovirus RNA but the KH3 domain is dispensable for viral RNA replication. The trun-cated protein (PCBP2-⌬KH3) is defective in translation initi-ation but remains active in RNA synthesis. The results

on November 8, 2019 by guest

[image:2.585.42.542.80.174.2]
(3)

sented here demonstrate how picornaviruses like poliovirus, coxsackievirus, and human rhinovirus may use the dual func-tionality of PCBP2 to maintain control over specific steps in the virus replication cycle.

MATERIALS AND METHODS

Plasmid design.(i) The synthetic oligonucleotide primers used were RP12(⫹) (5⬘CATGCCATGGGATCGCATCACCATCACCATCAC3⬘), RP13(⫺) (5⬘GG

TGGCATGGGGAGCAGCGACTACAAGGACGACGATGCAAGTAATAGG

AATTCCGG 3⬘), RP18(⫹) (5⬘GGCAATGCAAATCGATCATTTTCCCA 3⬘), RP19(⫺) (5⬘TGGGAAAATGATCGATTTGCATTGCC 3⬘), RP20(⫹) (5⬘GG

CAATGCAAGCTAGCCATTTTCCCA), RP21(⫹) (5⬘TGGGAAAATGGCT

AGCTTGCATTGCC 3⬘), RP22(⫹) (5⬘AATCGGGCGTGCTAGCGCCAAA

ATCA 3⬘), RP23(⫺) (5⬘ TGATTTTGGCGCTAGCACGCCCGATT 3⬘), RP24(⫹) (5⬘TATACCATGGGCAGCAGCCATCAT 3⬘), RP25(⫺) (5⬘ATCC TCGAGTTACTATTGACTCTG 3⬘), RP31(⫺) (5⬘CCGGAATTCTTACTACT GTTGCATTGC 3⬘), pET22b-PCPBP2(⫹) (5⬘GAT ATA CAT ATG GAC ACC GGT GTG ATT 3⬘), and pET22b-PCBP2(⫺) (5⬘GTG CTC GAG GCT GCT CCC CAT GCC ACC CGT CTC 3⬘).

(ii) pET28a-PCBP2-KH3.Synthetic oligonucleotide primers RP12(⫹) and RP31(⫺) were used to generate a PCR fragment containing nucleotides 121 to 930 of the pQE30-PCBP2 plasmid that was then cloned into pET28a (Novagen) by using the NcoI (RP12) and EcoRI (RP31) restriction sites. The resulting plasmid (pET28a-PCBP2-⌬KH3) encodes amino acids 1 to 253 of PCBP2 in pQE30-PCBP2, producing a protein that has an N-terminal hexahistidine tag (in italics in the primer sequence) and migrates at⬃26 kDa. Restriction sites are underlined in the primer sequences.

(iii) pET28a-PCBP2. Synthetic oligonucleotide primers RP12(⫹) and RP13(⫺) were used to generate a PCR fragment containing nucleotides 121 to 1266 of pQE30-PCBP2, which was cloned into pET28a by using NcoI and EcoRI (RP13). The FLAG tag sequence is in italics (above). The encoded protein has an N-terminal hexahistidine tag and a C-terminal FLAG tag.

(iv) pET28a-PCBP2 (Q253A, Q253I S254D, and Q306A).QuikChange mu-tagenesis (Stratagene) was used to generate the required mutations with the following synthetic oligonucleotide primers: Q253I S254D, RP18(⫹) and RP19(⫺); Q253A, RP20(⫹) and RP21(⫺); Q306A, RP22(⫹)and RP23(⫺). The template for mutagenesis was pET28a-PCBP2 (described above). The mutated proteins also have an N-terminal hexahistidine tag and a C-terminal FLAG tag. (v) pET22b-PCBP2.Synthetic oligonucleotides were used to generate a PCR fragment with pQE30-PCBP2 as the template. The resulting PCR fragment was cloned into pET22b at the NdeI and XhoI restriction sites. pQE30-PCBP1 (10), pQE30-PCBP2-mKH1 (69), and pQE30-PCBP2-⌬KH2 (6) have been previously described. pET15b-3CD(␮10) and pET15b-3C (C147A) were also described previously (52, 53).

(vi) pET15-3C (C147A).Synthetic oligonucleotides RP24(⫹) and RP(25⫺) were used for PCR mutagenesis to clone the C147A mutation into 3C. pET15b-3CD (C147A) was used as the template (53).

Purification of recombinant PCBPs. Purification of hexahistidine-tagged PCBP1 (from the pQE30-PCBP1 plasmid), PCBP2 (from the pQE30-PCBP2 plasmid), and mKH1 (from the pQE30-mKH1 plasmid) was carried out as previously described (53). Hexahistdine-tagged PCBP2-FLAG wild-type (WT) and mutated proteins (from pET28a-PCBP2) and PCBP2-⌬KH3 (from pET28a-PCBP2-⌬KH3) were expressed in BL21DE3(Rosetta) cells. Cells were grown at 37°C to anA600of 0.2 and then induced with isopropyl-␤-D

-thiogalactopyrano-side (IPTG; 1 mM final concentration) for 3 h at 25°C. Cells were lysed in buffer containing lysozyme (25 mM Tris-HCl [pH 8.0], 2.0⫻105

U/ml chicken egg white lysozyme␴) by incubation on ice for 30 min, followed by sonication. The soluble fraction following lysis was precipitated with ammonium sulfate (20%, wt/vol). The resulting pellet fraction was dialyzed for 4 h or overnight in I60 buffer (20 mM Tris-HCl [pH 7.9], 250 mM NaCl, 60 mM imidazole, 10% glyc-erol, 0.5% NP-40) and subjected to Ni2⫹ion-based affinity chromatography (GE Healthcare). PCBP2-containing fractions were pooled and further purified by size exclusion chromatography on an S200 Superdex column (GE Healthcare). The resulting proteins were⬃90% pure as determined by sodium dodecyl sul-fate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by Coomassie blue R250 staining. Purification of 3C (WT and C147A mutant) and 3CD (WT and C147A mutant) was carried out essentially as described by Parsley and coworkers (52).

In vitro cleavage of recombinant PCBPs. Recombinant purified proteins PCBP1 and PCBP2 (WT and Q253A, Q253I S254D, and Q306A mutant pro-teins) and the 3C (WT and C147A mutant) and 3CD (WT and C147A mutant)

proteinases were incubated at a 4:1 molar ratio of substrate to proteinase in cleavage buffer (20 mM HEPES [pH 7.4], 1 mM dithiothreitol [DTT], 150 mm potassium acetate [KOAc]) for 6 h at 30°C. The cleavage products were analyzed by SDS-PAGE and Western blotting with an anti-His (Abcam) or anti-FLAG primary monoclonal antibody (Stratagene), followed by an alkaline phosphatase-conjugated anti-mouse secondary antibody.

Mass spectrometry analysis of cleavage products.Cleavage reaction mixtures containing recombinant PCBP2 and recombinant 3C were resolved by SDS-PAGE and then blotted onto a polyvinylidene difluoride membrane via Western blotting methods. The isolated protein products were subjected to mass spec-trometry analysis, followed by N-terminal sequencing by the Protein Facility of the Iowa State University Office of Biotechnology.

RNA electrophoretic mobility shift analysis.RNA mobility shift assays were performed as previously described (69). Recombinant purified poliovirus 3CD (C147A) and/or recombinant purified PCBP2, PCBP2-⌬KH3, PCBP2-mKH1, or PCBP2-⌬KH2 were incubated in RNA-binding buffer (5 mM HEPES-KOH [pH 7.4], 25 mM KCl, 2.5 mM MgCl2, 20 mM dithiothreitol, 3.8% [vol/vol] glycerol,

1 mg/mlEscherichia colitRNA␴, 8 U of RNasin [Promega], 0.5 mg/ml bovine serum albumin [New England BioLabs]) for 10 min at 30°C. Proteins were then incubated with a radiolabeled poliovirus stem-loop I or stem-loop IV RNA probe at a final concentration of 5 nM in a 10-␮l reaction volume and incubated for 10 min at 30°C. Following incubation, 2.5␮l of 50% glycerol was added and the resulting complexes were resolved at 4°C on native 4% polyacrylamide gels.

HeLa cell S10 preparation and poly(rC) depletion of cytoplasmic extracts. Preparation of HeLa cell S10 cytoplasmic extracts was done essentially as pre-viously described (69). RNA affinity chromatography-mediated depletion of the extracts was also carried out as previously described (69), with the exception that ribosomal salt wash was not added to the extracts prior to depletion.

In vitro translation-RNA replication reaction mixtures.In vitro translation and RNA replication reaction mixtures were prepared with HeLa cell S10 ex-tracts by using the RibPVE2A(MluI) RNA as previously described (69), except that the reaction mixtures did not contain ribosomal salt wash and total RNA from the replication reaction mixtures was purified with an RNAqueous spin column (Ambion) as previously described (18).

In vitro translation and luciferase assays.Translation assays were carried out as previously described (68), with minor modifications. Briefly, 20-␮l reaction mixtures contained 50% HeLa cell S10 cytoplasmic extract; 50 fmol 5⬘PV-Luc (luciferase) reporter RNA (68); 1 mM ATP; 250␮M each GTP, CTP, and UTP; 30 mM creatine phosphate; 400␮g/ml creatine kinase (Boehringer Mannheim/ Roche); and 15% (by volume) ribosomal salt wash buffer containing PCBP2 (WT), PCBP2-⌬KH3, or buffer alone. The reaction mixtures were incubated at 30°C for 90 min, and reactions were terminated with passive lysis buffer (Pro-mega), followed by incubation on ice. The luciferase activity in 10␮l of sample was measured by adding 100␮l of reconstituted luciferase assay substrate (Pro-mega). Relative light units were measured for 10 s with a Berthold luminometer.

RESULTS

Endogenous PCBP is modified during poliovirus infection of cultured HeLa cells.The three proteinases (2A, 3C, and 3CD) encoded in the genomes of different picornaviruses mod-ify several cellular proteins during infection. As shown in Table 1, many of these modifications disrupt key cellular processes that would likely compete with virus replication. Since PCBP2 provides dual functions during translation and replication of the poliovirus genome, it seemed plausible that modification of this protein could initiate a switch in functionality. To deter-mine the fate of PCBP during a poliovirus infection, HeLa cells were mock infected or infected with poliovirus at a multiplicity of infection of 30. Cytoplasmic extracts were harvested from these cultures over a 7-h time course and analyzed by SDS-PAGE and Western blotting with PCBP polyclonal anti-serum (Fig. 1). During poliovirus infection, the native PCBP species (apparent molecular mass of⬃40 kDa) was observed to disappear with the concomitant appearance of a faster-migrating species of PCBP with an apparent molecular mass of

⬃26 kDa (Fig. 1, lanes 15 to 18). Furthermore, this faster-migrating species first detected at 3 h postinfection

on November 8, 2019 by guest

http://jvi.asm.org/

(4)

lates during the course of infection. This species is not ob-served in the mock-infected samples. The abundance of full-length PCBP also remained constant in the mock-infected samples. These results support the hypothesis that PCBP is modified during poliovirus infection of HeLa cells. It should be noted that the recombinant PCBP2 shown in lane 9 of Fig. 1 has an amino-terminal hexahistidine tag, thus accounting for its slower electrophoretic mobility than the authentic forms of PCBP from HeLa cells. In addition, the doublet observed migrating at a molecular mass of⬃40 kDa represents two of the four isoforms of PCBP in the cell. The specific isoform that is modified or the source of modification is not clear from these experiments. Therefore, inspection of the amino acid sequence of the PCBP isoforms for potential proteinase cleavage sites was a necessary next step in identifying the cleavage products.

3C/3CD consensus recognition sites are present in the amino acid sequences of PCBP isoforms.An amino acid se-quence alignment of all of the mouse and human sese-quences for the four isoforms of PCBP is shown in Fig. 2. The poliovirus proteinases 3C and 3CD specifically recognize cleavage sites with a glutamine (Q) at the P1 position and a glycine (G) at the P1⬘position of the scissile bond, although amino acids such as serine (S) or alanine (A) in the P1⬘position are also cleaved by picornavirus 3C enzymes. An alanine or other amino acid with a small, aliphatic side chain is preferred at the P4 position of the sequence (23). Two such consensus 3C/3CD proteinase cleavage sites were identified in a PCBP amino acid sequence alignment and are highlighted in Fig. 2. The first potential cleavage site, referred to as the pre-KH3 cleavage site, is in the linker between the KH2 and KH3 domains at position Q253 S254 (PCBP2 numbering), and the second putative site is at Q306 G307 in the KH3 domain and is referred to as the KH3 cleavage site. The pre-KH3 cleavage site has an alanine at the P4 position, which makes it an ideal 3C/3CD cleavage site. The P4 amino acid at the KH3 cleavage site is an isoleucine, and its presence would be predicted to reduce the rate of proteolytic cleavage compared to the presence of alanine in the same

position (51). Therefore, it was our hypothesis that PCBP2 is cleaved primarily at the pre-KH3 cleavage site. A consensus cleavage site for viral proteinase 2A was not found in the PCBP amino acid sequences. Several other Q/G amino acid pairs were observed in the PCBP1 and PCBP2 sequences; however, these sites did not have preferred amino acids at the P4 position of the scissile bond (data not shown). Since the only strong consensus 3C/3CD cleavage sites mapped to the linker region between KH2 and KH3 (pre-KH3 cleavage site) and the KH3 domain (KH3 cleavage site), only the sequences corresponding to these regions of interest are shown in Fig. 2. However, the alignments and potential cleavage site analyses were carried out for the complete amino acid sequences of all four PCBPs.

[image:4.585.137.450.68.241.2]

Recombinant PCBP2 is cleaved in vitro by recombinant 3C and 3CD proteinases.We predicted that PCBP could be di-rectly cleaved by the viral proteinases 3C and 3CD. To test this prediction, recombinant PCBP1, PCBP2, 3C, and 3CD were expressed inE.coli. All four proteins had an N-terminal hexa-histidine tag for purification and detection purposes. PCBP1 or PCBP2 was incubated with WT 3C or 3CD for 6 h at 30°C, and the cleavage products were analyzed by SDS-PAGE, followed by Western blot analysis with an anti-PCBP polyclonal serum. The recombinant 3C and 3CD proteinases with a C147A mu-tation in the active site (which inactivates the proteinase) were also included in the assay as negative controls. As shown in Fig. 3A, both PCBP1 and PCBP2 were cleaved by the 3C or 3CD proteinase but not by the inactive enzymes. Furthermore, the data indicate equivalent levels of cleavage by either proteinase under the conditions tested. We also analyzed the kinetics of in vitro proteolysis of PCBP2 by 3C or 3CD. Cleavage products of PCBP2 were detected within the first 30 min of incubation; no apparent differences in the rate of cleavage of PCBP2 by 3C or 3CD were observed (data not shown). It should be noted that we included recombinant PCBP1 as a substrate in the assay shown in Fig. 3A only to show that the 3C/3CD cleavage is site specific rather than isoform specific. Because PCBP1 has not

FIG. 1. PCBP cleavage products accumulate during poliovirus infection of HeLa cells. Crude extracts from mock-infected (lanes 1 to 8) or poliovirus-infected (lanes 11 to 18) HeLa cells were examined over a 7-h time course by Western blot analysis. The sample from each time point represents a crude extract from approximately 5⫻105HeLa cells. For size comparison, 0.5g of histidine-tagged recombinant PCBP2 (rPCBP2;

lane 9) and a molecular weight (MW) marker (lane 10) were included. Western blot analysis was carried out with rabbit polyclonal anti-PCBP serum as the primary antibody and an alkaline phosphatase-conjugated goat anti-rabbit (Sigma) secondary antibody. The electrophoretic mobilities of endogenous (uncleaved) PCBP isoforms and the putative cleavage products of PCBP are indicated by the arrows on the right.

on November 8, 2019 by guest

(5)

been definitively shown to be required for both translation and RNA replication of poliovirus RNA, we have focused the re-mainder of this study on PCBP2.

To determine whether PCBP cleavage by 3C/3CD occurred at the pre-KH3 cleavage site, the KH3 cleavage site, or both, a dual tagged form of PCBP2 with a hexahistidine tag at the N terminus and a FLAG tag at the C terminus of the protein was expressed inE.coli. The purified protein was incubated in an in vitro cleavage reaction mixture with 3C proteinase (Fig. 3B), and the reaction mixtures were analyzed by SDS-PAGE, fol-lowed by Western blot analysis with either His or anti-FLAG monoclonal antibodies. On the basis of the two possible cleavage sites, the expected molecular masses of the cleavage fragments are shown in Table 2. As shown in Fig. 3B, lane 5, a

⬃26-kDa cleavage fragment corresponding to the N-terminal portion of PCBP2 was observed with the anti-His antibody. A

⬃14-kDa fragment was observed with the FLAG anti-body. Both cleavage fragments were detected only in the re-action mixtures that contained active 3C proteinase and PCBP2, indicating that these fragments were the result of authentic proteolytic cleavage. Mass spectrometry and N-ter-minal sequence analysis of the cleaved fragments

demon-strated that the cleavage occurred at the pre-KH3 cleavage site (data not shown). The corresponding molecular masses deter-mined for each of the cleavage fragments (28 kDa and 12 kDa) are indicated in Table 2.

[image:5.585.135.450.71.367.2]

Mapping of the 3C and 3CD proteinase cleavage sites in PCBP2.To confirm the data obtained by mass spectrometry analyses, the pre-KH3 and KH3 cleavage sites were mutated to generate three mutated versions of PCBP2. The pre-KH3 cleavage site was mutated to Q253I S254D, where both the P1 and P1⬘ positions of the scissile bond were changed, and to Q253A, where only the P1 position was changed. At the KH3 cleavage site, a Q306A mutation was generated at the P1 position. By using the cleavage assay conditions described for the experiment shown in Fig. 3, the three recombinant forms of mutated PCBP2 were incubated with 3C or 3C (C147A). The resulting cleavage products were analyzed by immunoprecipi-tation of the cleavage reaction mixtures with anti-His mono-clonal antibody, followed by Western blot analysis with anti-PCBP polyclonal serum (Fig. 4). Immunoprecipitation was used in these assays because of impurities in some of the preparations of recombinant proteins that comigrated with the cleavage products and produced a high background level in

FIG. 2. Alignment of the human and mouse PCBP KH3 domain sequences showing putative 3C/3CD cleavage sites. The sequence alignment shown corresponds to the C-terminal region of the PCBPs (linker between KH2 and KH3 and the KH3 domain). The KH3 domain is in the white box. The positions of the putative scissile bonds for the two consensus 3C/3CD proteinase cleavage sites (pre-KH3 and KH3 cleavage site, respectively) are indicated, and the amino acids forming the cleavage site are boxed in gray. The critical fourth residue (P4 position) upstream of the putative cleavage site is indicated above or below the alignment. To the left of the amino acid sequences are the amino acid numbers for each protein. Several nonconsensus 3C/3CD cleavage sites have also been identified elsewhere in the PCBPs but are not indicated here. The PDB accession numbers for the human sequences are as follows: PCBP1, NM_006196; PCBP2, NM_005016; PCBP3, NM_020528; PCBP4, NM_033008. The PDB accession numbers for the mouse sequences are as follows: PCBP1, NM_011865; PCBP2, NM_011042; PCBP3, NM_021568; PCBP4, NM_021567.

on November 8, 2019 by guest

http://jvi.asm.org/

(6)

Western blot assays (data not shown). The results showed that the WT PCBP2 protein was cleaved by proteinase 3C (Fig. 4.), while the double mutation at the pre-KH3 cleavage site (Q253I S254D) rendered PCBP2 uncleavable by the purified

protein-ase. PCBP2 with a single mutation (Q253A) at the pre-KH3 cleavage site showed significantly reduced cleavage by 3C. These data suggest that both the P1 and P1⬘positions may be important for proteinase recognition of this cleavage site. PCPB2 with a mutation at the KH3 cleavage site (Q306A) was cleaved by 3C, albeit to a lower extent than the WT protein. This site may also be used for cleavage by 3C/3CD but is not the major site cleaved within PCBP2.

[image:6.585.132.449.66.430.2]

Differential binding of PCBP2-KH3 to stem-loop struc-tures in the 5NCR of viral RNA.To test the biological func-tion(s) of a truncated version of PCBP2 that would be the equivalent of a product of proteolytic cleavage at the pre-KH3

FIG. 3. Recombinant PCBP1 and PCBP2 are proteolytically cleaved in vitro by 3C and 3CD. (A) Purified preparations of recombinant PCBP1 or PCBP2 were incubated with recombinant 3C, 3CD, or inactive forms of both proteinases (C147A mutant forms). The substrate and proteinase at a concentration of 20␮M each were incubated in cleavage buffer (20 mM HEPES [pH 7.4], 1 mM DTT, 1 mM EDTA, 0.15 M KOAc) at 30°C for 6 h. The cleavage reaction mixtures were analyzed by Western blotting with anti-PCBP rabbit polyclonal serum. (Top) Lane 1, recombinant PCBP1 (rPCBP1) incubated alone; lane 2, rPCBP1 incubated with 3C; lane 3, rPCBP1 incubated with 3C (C147A); lane 4, rPCBP1 incubated with 3CD; lane 5, rPCBP1 incubated with 3CD (C147A). (Bottom) Lane 1, rPCBP2 incubated alone; lane 2, rPCBP2 incubated with 3C; lane 3, rPCBP2 incubated with 3C (C147A); lane 4, rPCBP2 incubated with 3CD; lane 5, rPCBP2 incubated with 3CD (C147A). The relative electrophoretic mobilities of uncleaved and cleaved PCBP are indicated by arrows on the left, and the molecular masses of two marker polypeptides are indicated on the right. (B) Two cleavage fragments are observed upon the cleavage of recombinant PCBP2 by 3C. Increasing amounts of recombinant PCBP2 were incubated with recombinant 3C in cleavage buffer (20 mM HEPES [pH 7.4], 1 mM DTT, 150 mm KOAc) for 6 h at 30°C. The cleavage products were analyzed by Western blotting. PCBP2 has a hexahistidine tag at the N terminus and a FLAG epitope tag at the C terminus. 3C has a hexahistidine tag at the N terminus. (Top) An anti-histidine monoclonal antibody was used as the primary antibody. (Bottom) An anti-FLAG monoclonal antibody was used as the primary antibody. Lane 1, PCBP2 alone; lane 2, 3C alone; lanes 3 to 5, 50, 75, and 150 pmol of PCBP2 incubated with 50 pmol of 3C proteinase. Two cleavage products of PCBP2 are shown in lanes 4 and 5, an N-terminal fragment (⬃26 kDa) detected with the anti-histidine antibody and a C-terminal fragment (⬃14 kDa) detected with the anti-FLAG antibody.

TABLE 2. Cleavage products of PCBP2

PCBP2 Cleavage product sizes (kDa)

Predicted Observed

Pre-KH3 cleavage site 28, 12 26, 14

KH3-cleavage site 34, 6 None

on November 8, 2019 by guest

[image:6.585.43.284.670.726.2]
(7)

site, we generated a recombinant protein lacking the sequences downstream of this site, including the entire KH3 domain. This protein, called PCBP2-⌬KH3, was purified fromE. coliand used in electrophoretic mobility shift assays with either stem-loop I (also known as cloverleaf) or stem-stem-loop IV in the 5⬘ NCR of poliovirus RNA. On the basis of previous studies that analyzed the RNA-binding properties of mutated polypeptides with charge-to-alanine substitutions in the KH3 domain of PCBP2, as well as the functional consequences of such muta-tions for viral translation and RNA replication (69), we pre-dicted that PCBP2-⌬KH3 would be unable to bind efficiently to stem-loop IV RNA but might retain its ability to form an RNP complex with stem-loop I. Results from mobility shift experiments with recombinant PCBP2 (WT) or PCBP2-⌬KH3 protein and stem-loop IV RNA are displayed in Fig. 5A. Only the WT version of PCBP2 formed an RNP complex with the stem-loop IV RNA (represented by a slower-migrating species in lanes 6 and 7, Fig. 5A). Similar concentrations of

PCBP2-⌬KH3 failed to shift the stem-loop IV RNA probe (lanes 12 and 13, Fig. 5A). Higher concentrations of PCPB2-⌬KH3 were also tested with similar results (data not shown).

To analyze the binding of PCBP2-⌬KH3 to stem-loop I RNA, we assayed for the formation of a ternary complex that is formed between the RNA and two binding partners, PCBP2 and poliovirus protein 3CD. The formation of this complex has previously been shown to be essential for poliovirus RNA synthesis (28, 53). As shown in Fig. 5B, lanes 5 and 6, a slow-migrating, heterogeneous complex was formed following the addition of WT PCBP2 and recombinant 3CD to labeled stem-loop I RNA. This complex was not observed when the individual proteins were used in binding assays (Fig. 5B, lanes 2 and 3). As shown in Fig. 5B, lanes 9 and 10, PCBP2-⌬KH3 was capable of forming a ternary complex with stem-loop I RNA and viral protein 3CD. Although this complex was more diffuse than the one detected with WT PCBP2, the formation

of a ternary complex with stem-loop I RNA by PCBP2-⌬KH3 suggests that the proteolytic cleavage of PCBP2 may not dis-rupt the ability of the protein to generate a functional RNA replication complex. It should be noted that PCBP2-⌬KH3 appears to have a lower affinity for stem-loop I than does the WT protein (Fig. 5B). At a concentration of 500 nM

PCBP2-⌬KH3, ternary complex formation was⬃45% of the WT level (compare lanes 5 and 9 in Fig. 5B), while at 1,000 nM

PCBP2-⌬KH3, ternary complex formation was⬃65% of the WT level (compare lanes 6 and 10 in Fig. 5B). The lower affinity of PCBP2-⌬KH3 may reflect the loss of the KH3 domain-medi-ated stabilization of PCBP2 binding to stem-loop I that we have previously noted (69), or it may be due to overall changes in protein folding mediated by the loss of a major structural domain of PCBP2. Mutated PCPB2 proteins mKH1-2 and

⌬KH2 were included as negative controls (Fig. 5B, lanes 11 to 14), since these proteins have previously been shown to be defective in RNA binding (6, 69).

[image:7.585.133.450.69.262.2]

Cleaved PCBP2 does not function in poliovirus translation in vitro.To determine if the cleaved form of PCBP2 was still active in poliovirus translation, in vitro translation assays were carried out with a dicistronic viral RNA, RibPVE2A(MluI), as previously described (48, 69). As shown in Fig. 6A, the P1 structural polyprotein of poliovirus is translated with the type I IRES of poliovirus while the P2 and P3 nonstructural pre-cursors are translated via the type II IRES element of encepha-lomyocarditis virus (EMCV; which does not require PCBP2 to function). Therefore, when RNA from this construct was used for in vitro translation reactions in PCBP-depleted HeLa cell cytoplasmic extracts, the nonstructural proteins were trans-lated without the addition of exogenous PCBP2. However, translation of the structural proteins (through the type I IRES) required the addition of recombinant PCBP2 to the depleted extracts (69). This in vitro translation assay was used to deter-mine the ability of PCBP2-⌬KH3 to rescue translation in

FIG. 4. Cleavage site mutations prevent 3C/3CD-mediated cleavage of PCBP2. Two mutations were constructed at the pre-KH3 cleavage site (Q253I S254D and Q253A), and one mutation was generated at the KH3 cleavage site in PCBP2. Recombinant WT and mutant proteins were incubated with the 3C, 3C (C147A), 3CD, or 3CD (C147A) proteinase under the cleavage assays conditions described in the legend to Fig. 3. Cleavage reaction mixtures were analyzed by immunoprecipitation with an anti-histidine monoclonal antibody, followed by Western blotting with anti-PCBP polyclonal serum. 3C (C147A) corresponds to the C147A mutation of the proteinase. Uncleaved and cleaved PCBP are indicated.

on November 8, 2019 by guest

http://jvi.asm.org/

(8)

PCBP-depleted extracts compared to the WT protein. Figure 6B shows the results of translating RibPVE2A(MluI) RNA in nondepleted (lane 1), mock-depleted (lane 2), or PCBP-de-pleted HeLa cell cytoplasmic extracts (lanes 5 to 16). Recom-binant PCBP2 (WT) or recomRecom-binant PCBP2-⌬KH3 was added to the PCBP-depleted extracts to rescue the translation of the P1 polyprotein. The results show that the WT protein could rescue translation in PCBP-depleted extracts in a dose-depen-dent manner, as indicated by the synthesis of the P1 structural precursor and its cleavage products VP0, VP1, and VP3. How-ever, PCBP2-⌬KH3 could not rescue translation to any signif-icant levels (Fig. 6B, lanes 10 to 14), suggesting that the 3C/ 3CD proteinase-mediated cleavage of PCBP2 impairs the function of this protein in poliovirus translation. A mutated form of PCBP2, mKH1-2, was used as a negative control in the

translation reaction mixtures. This mutated PCBP2 is defective in binding stem-loop IV of the poliovirus IRES and therefore cannot rescue poliovirus type I IRES-driven translation (69).

[image:8.585.136.447.70.433.2]

To quantify the reduced levels of translation produced by the addition of PCBP2-⌬KH3 to in vitro translation assay mix-tures, we used a luciferase reporter gene fused to the poliovirus 5⬘ NCR (5⬘PV-Luc) in mock-depleted or PCBP-depleted HeLa cell cytoplasmic extracts (Fig. 7). These in vitro transla-tion assay mixtures were supplemented by the additransla-tion of re-combinant PCBP2 (WT) or PCBP2-⌬KH3 protein. As shown in Fig. 7, the maximum level of translation stimulated by PCBP2-⌬KH3 was less than 20% of that stimulated by WT PCBP2. When recombinant PCBP2-⌬KH3 was added to non-depleted HeLa cell S10 extracts, the translation of 5⬘PV-Luc could not be inhibited (data not shown). Thus, PCBP2-⌬KH3

FIG. 5. Differential RNA-binding capacities of PCBP2 and PCBP2-⌬KH3. (A) RNA mobility shift assays performed as described in reference 69 and Materials and Methods. Recombinant purified PCBP2 or PCBP2-⌬KH3 was incubated with a radiolabeled poliovirus stem-loop IV RNA probe. Following incubation, the resulting complexes were resolved on a native 4% polyacrylamide gel. The electrophoretic mobility of the RNP complex between stem-loop IV RNA and PCBP2 is indicated on the right (S-L IV/PCBP2), as is that of the free stem-loop IV probe (Free S-L IV). (B) RNA mobility shift assay with recombinant purified PCBP2, PCBP2-⌬KH3, mKH1-2, and⌬KH2 in the absence or presence of poliovirus 3CD (C147A) to analyze the abilities of the different forms of PCBP2 to form a ternary complex with 3CD and stem-loop I RNA (also known as cloverleaf RNA). The radiolabeled probe corresponded to poliovirus stem-loop I RNA, and the conditions of incubation and electrophoretic separation were as described for panel A. The protein concentrations in each reaction mixture are indicated above the autoradiograph of the gel. Complexes formed with stem-loop I RNA and PCBP2 or 3CD alone, as well as the ternary complex formed with stem-loop I RNA, PCBP2 or PCBP2-⌬KH3, and 3CD are indicated. As described in the text, mKH1-2 and⌬KH2 are mutated forms of PCBP2 that are unable to bind to stem-loop I or stem-loop IV in the poliovirus 5⬘NCR.

on November 8, 2019 by guest

(9)

appears to be unable to incorporate itself into functional trans-lation initiation complexes and act as a dominant negative inhibitor of translation.

Cleaved PCBP2 is active in poliovirus RNA replication. Al-though PCBP2-⌬KH3 was unable to function in translation because of its inability to bind to stem-loop IV in the 5⬘NCR

of viral RNA, it still binds to stem-loop I and forms a ternary complex with 3CD. Therefore, we predicted that this protein should retain its ability to function in viral RNA replication. To test this prediction, we made use of the dicistronic RNA con-struct (noted above) because it allows the uncoupling of po-liovirus translation in vitro from RNA replication via

transla-FIG. 6. Rescue of viral RNA translation in PCBP-depleted HeLa cell S10 extracts. (A) Genetic organization and processing map of dicistronic poliovirus RNA used for in vitro translation and RNA replication assays. The values in parentheses are the molecular masses (in kilodaltons) of precursor polypeptides and proteolytic cleavage products produced following the translation of this RNA. (B) In vitro translation reaction mixtures prepared with either nondepleted (lane 1), mock-depleted (lane 2), or PCBP-depleted (lanes 4 to 17) HeLa cell cytoplasmic S10 extracts with the dicistronic replicon RNA, RibPVE2A(MluI), as previously described (69). The depleted extracts were supplemented with recombinant PCBP2 (WT),⌬KH3, or mKH1-2 at the indicated concentrations. The mutated PCBP2 protein mKH1-2 was used as a negative control since it is unable to function in translation (see reference 68). Synthesis of the structural polyprotein (P1) and its cleavage products (VP0, VP1, and VP3) was used as an indicator of differential translation between the⌬KH3- and PCBP2 (WT)-supplemented reaction mixtures.

on November 8, 2019 by guest

http://jvi.asm.org/

[image:9.585.130.451.70.566.2]
(10)

tion of the nonstructural proteins from the EMCV IRES (69). We determined if the amino-terminal cleavage fragment of PCBP2 (PCBP2-⌬KH3) was able to rescue RibPVE2A(MluI) RNA replication in PCBP-depleted HeLa cell cytoplasmic ex-tracts. The results shown in Fig. 8 demonstrated that both PCBP2 (WT) and PCBP2-⌬KH3 could rescue RNA replica-tion in a dose-dependent manner. The level of rescue by PCBP2-⌬KH3 was slightly lower than that of the WT protein (compare lane 5 to lanes 10, Fig. 8), perhaps reflecting its lower affinity for stem-loop I upon loss of the KH3 domain. As

mentioned earlier, even though the KH1 domain is the primary determinant for RNA binding, the KH3 domain also makes a contribution to the binding of stem-loop I (69). It should be noted that at the highest concentration of PCBP2-⌬KH3 used in this assay (500 nM), the mutated protein reproducibly ap-pears to cause an inhibition of RNA synthesis. This may sug-gest an altered state of multimerization at high concentrations of the truncated protein or perturbation of the binding equi-librium between the ternary complex and the viral RNA-de-pendent RNA polymerase required for initiation of

[image:10.585.138.449.67.315.2]

replica-FIG. 7. Rescue of poliovirus translation in PCBP-depleted HeLa cell cytoplasmic S10 extracts. The translation of a luciferase reporter gene driven by the poliovirus IRES was analyzed in HeLa cell cytoplasmic S10 extracts that were either mock depleted, depleted of PCBP, or depleted of PCBP and reconstituted with recombinant WT PCBP orKH3 protein. The translation reaction mixtures were prepared in triplicate and incubated at 30°C for 1.5 h. Luciferase assays were carried out with 10␮l of the translation reaction mixture as previously described (68). RLU, relative light units.

FIG. 8. Rescue of viral RNA replication in PCBP-depleted HeLa cell S10 extracts. In parallel experiments to the in vitro translation reactions shown in Fig. 6B, in vitro RNA replication reaction mixtures were prepared with either nondepleted (lane 1) or PCBP-depleted (lanes 3 to 16) HeLa cell cytoplasmic S10 extracts with the dicistronic replicon RNA RibPVE2A(MluI) as the template. The depleted extracts were supplemented with recombinant PCBP2 (WT),⌬KH3, or mKH1-2 at the indicated concentrations. As a negative control, 2 mM guanidine hydrochloride (GuHCl) was added to an S10 extract sample to inhibit RNA replication (lane 2). Replicated poliovirus (PV) RNA is indicated on the left.

on November 8, 2019 by guest

[image:10.585.136.448.526.680.2]
(11)

tion. Importantly, the ability of PCBP2-⌬KH3 to rescue the replication of the dicistronic RNA provides direct evidence that the KH3 domain is dispensable for RNA replication. These data are also in agreement with previous studies that showed the primary function of the KH3 domain to be trans-lation initiation, perhaps by recruiting ribosomes to the viral RNA through its interaction with SRp20 (5).

DISCUSSION

It has been previously shown that PCBP2 is required for both translation and replication of the poliovirus genome. When HeLa cell cytoplasmic S10 extracts were depleted of endogenous PCBP, translation of the poliovirus genome was reduced by approximately 5- to 10-fold. Translation could be rescued to near mock-depleted levels only upon addition of recombinant PCBP2 (but not PCBP1) and SRp20 (5, 11, 69). These data suggested that among all of the isoforms of PCBP, PCBP2 plays a primary role in translation initiation on the poliovirus IRES. This was attributed to its ability to form a high-affinity RNP complex with stem-loop IV on the IRES (69). Both the KH1 and KH3 domains of PCBP2 were identi-fied as important RNA-binding determinants in this RNP com-plex (62, 69). In addition, the KH2 domain was shown to mediate the dimerization of PCBP2, and this dimerization was required for its interaction with stem-loop IV (6). The impor-tance of the individual KH domains of PCBP2 in poliovirus IRES-driven translation was further revealed when Bedard and colleagues demonstrated that the KH3 domain interacts with the cellular protein SRp20, a serine-arginine-rich protein involved in pre-mRNA splicing and mRNA nucleocytoplasmic transport (5). This interaction is required for maximum stim-ulation of translation initiation directed by the poliovirus IRES, an observation suggesting that the KH3 domain within the SL-IV/PCBP2/SRp20 complex may function to recruit ri-bosomes to the viral RNA.

In the present study, we found that the KH3 domain of PCBP2 was removed via a proteolytic cleavage that occurred during the mid-to-late phase of a poliovirus infection. The resulting cleavage fragment, PCBP2-⌬KH3 (harboring only the KH1 and KH2 domains), was unable to form a functional RNP complex with stem-loop IV in the poliovirus IRES. Fur-thermore, in vitro translation assays demonstrated that recom-binant PCBP2-⌬KH3 could not rescue the translation of a dicistronic poliovirus RNA or a 5⬘PV-Luc reporter construct in HeLa cell cytoplasmic extracts depleted of PCBP. Thus, the proteolytic removal of the KH3 domain disrupted the ability of PCBP2 to function in poliovirus translation. If translation ini-tiation is disrupted on a viral RNA, it may prime the RNA for replication, a process that cannot proceed when translation is in progress. Proteolytic cleavage of PCBP2 within a preformed translation initiation complex on a specific viral RNA could be a mechanism for selecting that template for RNA replication. Alternatively, cleavage of free PCBP2 may also reduce the pool of translation-competent polypeptides, thus allowing newly synthesized positive-strand RNAs to serve as templates for negative-strand RNA synthesis rather than for further rounds of protein synthesis. In poliovirus-infected cells, the PCBP2 that is cleaved is likely found within localized environ-ments associated with translation and RNA replication

com-plexes. These replication complexes are within membranous compartments that may restrict the free diffusion of the 3C/ 3CD proteins. Therefore, all of the PCBP2 that is found within the cell would not be expected to be cleaved because of inac-cessibility to the viral proteinase.

The scenario described above requires that the cleavage fragment, PCBP2-⌬KH3, is still able to function in viral RNA replication. Indeed, we found that PCBP2-⌬KH3 maintained its ability to form a functional RNP complex with stem-loop I within the poliovirus 5⬘NCR. This RNP complex, which also includes viral protein 3CD, has been previously shown to be essential for initiation of viral RNA synthesis. It may function to circularize the viral genome through its interaction with poly(A)-binding protein (PABP) bound to the 3⬘poly(A) tract. This circularization is predicted to bring several essential RNP complexes within close proximity for initiation of negative-strand RNA synthesis (4, 33). Therefore, the ability of

PCBP2-⌬KH3 to form a functional RNP complex on stem-loop I is an important observation and supports the hypothesis that it may be active in viral RNA replication. More importantly, our in vitro RNA replication assays carried out with HeLa cell cytoplasmic extracts depleted of endogenous PCBP demonstrated that recombinant PCBP2-⌬KH3 could rescue viral RNA replication. The ability of the cleaved protein to function in viral RNA replication, but not in translation, supports our hypothesis that viral proteinase-mediated cleavage of PCBP2 is, in part, a mechanism that modulates the opposing processes of translation and RNA replication during a poliovirus infection.

Model of poliovirus template selection during translation and replication of the genome.On the basis of the data derived from this study, as well as previously reported observations by other investigators, a model of PCPB2-mediated template se-lection is proposed in Fig. 9. Following the initial rounds of translation and RNA replication during the early phases of the poliovirus infectious cycle (Fig. 9A), the positive-strand viral genome is used as the template for translation, leading to high-level synthesis of viral proteins, including the 3C/3CD proteinases. These proteins mediate the cleavage of endoge-nous PCBP1 and PCBP2 in the cytoplasm of the infected cell (Fig. 9B). This cleavage releases the KH3 domain, and as a result, SRp20, from the stem-loop IV/PCBP2/SRp20 complex, rendering it inactive in translation initiation. The remaining cleavage fragment (PCBP2-⌬KH3) loses its affinity for stem-loop IV. Because of a lack of new initiation events, the viral RNA is eventually cleared of translating ribosomes and be-comes available to function as the template in negative-strand RNA synthesis. The cleaved form of PCBP2 (PCBP2-⌬KH3) is still able to bind stem-loop I, where it forms a ternary complex with 3CD. This ternary complex may interact with PABP bound to the 3⬘ end of the viral genome to circularize the template, thereby allowing RNA replication to proceed.

In our model, PCBP2 plays a major role in both the trans-lation and the replication of the poliovirus genome, and the observations in this study have allowed a PCBP2-mediated mechanism to be proposed for template selection. However, a mechanism that includes other cellular proteins such as PTB may also need to be considered in light of the significant intracellular protein modifications and vesicle rearrangements observed during picornavirus infections. Furthermore, the

on November 8, 2019 by guest

http://jvi.asm.org/

(12)

posed model does not assume complete cleavage of PCBP2 or complete down regulation of translation, as this has not been observed during poliovirus infections. Rather, it proposes a shift in the balance of activities between two processes (trans-lation and RNA replication) within localized environments surrounding specific RNA templates.

It should be noted that the proposed mechanism of template selection is most likely not used by picornaviruses like EMCV or foot-and-mouth disease virus. These viruses with type II IRES elements do not appear to use PCBP2 during translation of the viral genome, and to date there have been no reports of a PCPB2 requirement for cardiovirus or aphthovirus RNA

[image:12.585.120.475.67.413.2]

replication. It will be interesting to determine the alternative mechanisms that drive template selection for these and other positive-strand RNA viruses. Finally, PCBP2 has been identi-fied in RNP complexes in other viral systems such as hepatitis C virus and human papillomavirus type 16. Although an inter-action of PCBP2 with the hepatitis C virus IRES has been observed, the functional significance of this binding is unknown (64). For human papillomavirus, PCBP2 is used as a transla-tional regulator of late gene expression (16). Collectively, these data suggest that PCBP2 is a multifunctional cellular protein that falls victim to molecular scavenging by several different viruses. However, its ability to control virus replication via

FIG. 9. Model of template selection during poliovirus translation and viral RNA replication. Depicted is poliovirus positive-strand RNA (black line) under conditions that favor cap-independent translation (A) or those that favor negative-strand RNA synthesis (B). Under conditions that favor translation early during the infectious cycle (A), the RNA is bound by ribosomes (designated 80S on the gray spheres) continuously initiating and elongating nascent viral polypeptide chains (depicted as orange curly lines). Initiation of translation is facilitated by the binding of cellular protein PCBP2 to the poliovirus IRES in the 5⬘NCR of positive-strand RNA (secondary structures with thickened black lines) and the possible bridging of RNA to the ribosome by the cellular protein SRp20. The presence of multiple ribosomes on viral RNA may preclude the viral RNA polymerase (3D) from elongating any newly initiated negative-strand RNAs. Under conditions that favor negative-strand RNA synthesis later during the infectious cycle (B), PCBP2 has been cleaved by the accumulated 3CD (or 3C) proteinase polypeptides (as indicated by the orange arrow). This inhibits the binding of ribosomes to the IRES, thereby reducing the levels of translation initiation complex formation and releasing SRp20 from PCBP2. The cleaved form of PCBP2 (PCBP2-⌬KH3) can still participate in ternary complex formation with the 5⬘stem-loop I structure and 3CD. This may facilitate the interaction of the 5⬘RNP complex with the 3⬘poly(A) tract via a bridging interaction with PABP. This latter interaction would lead to initiation of negative-strand RNA synthesis on templates that are now cleared of translating ribosomes. The gray arrows indicate the direction of ribosomes traversing the RNA during translation, while the red arrows indicate the direction of the 3D RNA polymerase during negative-strand RNA synthesis. The blue lines represent nascent negative-strand RNAs with a VPg (small solid red circle) at their 5⬘ends. The UUUUUU sequence represents the 5⬘oligo(U) tract that is templated by the 3⬘poly(A) tract on genomic positive-strand RNAs. The separation of the two processes is shown for illustration only; it is likely that the viral replication cycle is a dynamic process with both activities occurring simultaneously (but not on the same template RNA).

on November 8, 2019 by guest

(13)

multiple mechanistic roles is only now beginning to be under-stood.

ACKNOWLEDGMENTS

We are grateful to Polen Sean for insightful discussions and to Mayuri and Ranjan Sengupta for critical readings of the manuscript. We also thank Kristin Bedard and Todd Parsley for generous gifts of reagents.

This work was supported by Public Health Service grant AI 26765 from the National Institutes of Health. R.P. was supported, in part, by a UC Irvine faculty career development award, and B.L.W. was sup-ported by a research fellowship from the American Heart Association, Western States Affiliate.

REFERENCES

1.Andino, R., G. E. Rieckhof, and D. Baltimore.1990. A functional ribonucle-oprotein complex forms around the 5⬘end of poliovirus RNA. Cell63:369– 380.

2.Back, S. H., Y. K. Kim, W. J. Kim, S. Cho, H. R. Oh, J. E. Kim, and S. K. Jang. 2002. Translation of polioviral mRNA is inhibited by cleavage of polypyrimidine tract-binding proteins executed by polioviral 3C(pro). J. Vi-rol.76:2529–2542.

3.Barton, D. J., B. J. Morasco, and J. B. Flanegan.1999. Translating ribosomes inhibit poliovirus negative-strand RNA synthesis. J. Virol.73:10104–10112. 4.Barton, D. J., B. J. O’Donnell, and J. B. Flanegan.2001. 5⬘cloverleaf in poliovirus RNA is a cis-acting replication element required for negative-strand synthesis. EMBO J.20:1439–1448.

5.Bedard, K. M., S. Daijogo, and B. L. Semler.2007. A nucleo-cytoplasmic SR protein functions in viral IRES-mediated translation initiation. EMBO J. 26:459–467.

6.Bedard, K. M., B. L. Walter, and B. L. Semler.2004. Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES. RNA10:1266–1276.

7.Belov, G. A., A. G. Evstafieva, Y. P. Rubtsov, O. V. Mikitas, A. B. Vartapetian, and V. I. Agol.2000. Early alteration of nucleocytoplasmic traffic induced by some RNA viruses. Virology275:244–248.

8.Belov, G. A., P. V. Lidsky, O. V. Mikitas, D. Egger, K. A. Lukyanov, K. Bienz, and V. I. Agol.2004. Bidirectional increase in permeability of nuclear enve-lope upon poliovirus infection and accompanying alterations of nuclear pores. J. Virol.78:10166–10177.

9.Bienz, K., D. Egger, and L. Pasamontes.1987. Association of polioviral proteins of the P2 genomic region with the viral replication complex and virus-induced membrane synthesis as visualized by electron microscopic im-munocytochemistry and autoradiography. Virology160:220–226. 10.Blyn, L. B., K. M. Swiderek, O. Richards, D. C. Stahl, B. L. Semler, and E.

Ehrenfeld.1996. Poly(rC) binding protein 2 binds to stem-loop IV of the poliovirus RNA 5⬘ noncoding region: identification by automated liquid chromatography-tandem mass spectrometry. Proc. Natl. Acad. Sci. USA 93:11115–11120.

11.Blyn, L. B., J. S. Towner, B. L. Semler, and E. Ehrenfeld.1997. Requirement of poly(rC) binding protein 2 for translation of poliovirus RNA. J. Virol. 71:6243–6246.

12.Buenz, E. J., and C. L. Howe.2006. Picornaviruses and cell death. Trends Microbiol.14:28–36.

13.Chkheidze, A. N., and S. A. Liebhaber.2003. A novel set of nuclear local-ization signals determine distributions of the␣CP RNA-binding proteins. Mol. Cell. Biol.23:8405–8415.

14.Clark, M. E., T. Hammerle, E. Wimmer, and A. Dasgupta.1991. Poliovirus proteinase 3C converts an active form of transcription factor IIIC to an inactive form: a mechanism for inhibition of host cell polymerase III tran-scription by poliovirus. EMBO J.10:2941–2947.

15.Clark, M. E., P. M. Lieberman, A. J. Berk, and A. Dasgupta.1993. Direct cleavage of human TATA-binding protein by poliovirus protease 3C in vivo and in vitro. Mol. Cell. Biol.13:1232–1237.

16.Collier, B., L. Goobar-Larsson, M. Sokolowski, and S. Schwartz.1998. Translational inhibition in vitro of human papillomavirus type 16 L2 mRNA mediated through interaction with heterogenous ribonucleoprotein K and poly(rC)-binding proteins 1 and 2. J. Biol. Chem.273:22648–22656. 17.Collis, P. S., B. J. O’Donnell, D. J. Barton, J. A. Rogers, and J. B. Flanegan.

1992. Replication of poliovirus RNA and subgenomic RNA transcripts in transfected cells. J. Virol.66:6480–6488.

18.Cornell, C. T., R. Perera, J. E. Brunner, and B. L. Semler.2004. Strand-specific RNA synthesis determinants in the RNA-dependent RNA polymer-ase of poliovirus. J. Virol.78:4397–4407.

19.CzyzykKrzeska, M. F., W. R. Paulding, J. E. Beresh, and S. L. Kroll.1997. Post-transcriptional regulation of tyrosine hydroxylase gene expression by oxygen in PC12 cells. Kidney Int.51:585–590.

20.Das, S., and A. Dasgupta.1993. Identification of the cleavage site and

determinants required for poliovirus 3CPro-catalyzed cleavage of human TATA-binding transcription factor TBP. J. Virol.67:3326–3331. 21.Delhaye, S., V. van Pesch, and T. Michiels.2004. The leader protein of

Theiler’s virus interferes with nucleocytoplasmic trafficking of cellular pro-teins. J. Virol.78:4357–4362.

22.Devaney, M. A., V. N. Vakharia, R. E. Lloyd, E. Ehrenfeld, and M. J. Grubman.1988. Leader protein of foot-and-mouth disease virus is required for cleavage of the p220 component of the cap-binding protein complex. J. Virol.62:4407–4409.

23.Dougherty, W. G., and B. L. Semler. 1993. Expression of virus-encoded proteinases: functional and structural similarities with cellular enzymes. Mi-crobiol. Rev.57:781–822.

24.Du, Z., J. Yu, Y. Chen, R. Andino, and T. L. James.2004. Specific recognition of the C-rich strand of human telomeric DNA and the RNA template of human telomerase by the first KH domain of human poly(C)-binding pro-tein-2. J. Biol. Chem.279:48126–48134.

25.Du, Z. H., J. K. Lee, R. Tjhen, S. Li, H. Pan, R. M. Stroud, and T. L. James. 2005. Crystal structure of the first KH domain of human poly(C)-binding protein-2 in complex with a C-rich strand of human telomeric DNA at 1.7 Å. J. Biol. Chem.280:38823–38830.

26.Etchison, D., S. C. Milburn, I. Edery, N. Sonenberg, and J. W. Hershey. 1982. Inhibition of HeLa cell protein synthesis following poliovirus infection correlates with the proteolysis of a 220,000-dalton polypeptide associated with eucaryotic initiation factor 3 and a cap binding protein complex. J. Biol. Chem.257:14806–14810.

27.Evans, J. R., S. A. Mitchell, K. A. Spriggs, J. Ostrowski, K. Bomsztyk, D. Ostarek, and A. E. Willis.2003. Members of the poly(rC) binding protein family stimulate the activity of the c-myc internal ribosome entry segment in vitro and in vivo. Oncogene22:8012–8020.

28.Gamarnik, A. V., and R. Andino.1997. Two functional complexes formed by KH domain containing proteins with the 5⬘noncoding region of poliovirus RNA. RNA3:882–892.

29.Gamarnik, A. V., and R. Andino.1998. Switch from translation to RNA replication in a positive-stranded RNA virus. Genes Dev.12:2293–2304. 30.Gamarnik, A. V., and R. Andino.2000. Interactions of viral protein 3CD and

poly(rC) binding protein with the 5⬘untranslated region of the poliovirus genome. J. Virol.74:2219–2226.

31.Gustin, K. E., and P. Sarnow.2001. Effects of poliovirus infection on nucleo-cytoplasmic trafficking and nuclear pore complex composition. EMBO J. 20:240–249.

32.Gustin, K. E., and P. Sarnow.2002. Inhibition of nuclear import and alter-ation of nuclear pore complex composition by rhinovirus. J. Virol.76:8787– 8796.

33.Herold, J., and R. Andino.2001. Poliovirus RNA replication requires ge-nome circularization through a protein-protein bridge. Mol. Cell7:581–591. 34.Holcik, M., and S. A. Liebhaber.1997. Four highly stable eukaryotic mRNAs assemble 3⬘untranslated region RNA-protein complexes sharing cis and trans components. Proc. Natl. Acad. Sci. USA94:2410–2414.

35.Joachims, M., and D. Etchison.1992. Poliovirus infection results in struc-tural alteration of a microtubule-associated protein. J. Virol.66:5797–5804. 36.Joachims, M., K. S. Harris, and D. Etchison.1995. Poliovirus protease 3C mediates cleavage of microtubule-associated protein 4. Virology211:451– 461.

37.Joachims, M., P. C. Van Breugel, and R. E. Lloyd. 1999. Cleavage of poly(A)-binding protein by enterovirus proteases concurrent with inhibition of translation in vitro. J. Virol.73:718–727.

38.Kiledjian, M., X. Wang, and S. A. Liebhaber.1995. Identification of two KH domain proteins in the␣-globin mRNP stability complex. EMBO J.14:4357– 4364.

39.Ko, J. L., and H. H. Loh.2005. Poly C binding protein, a single-stranded DNA binding protein, regulates mouse mu-opioid receptor gene expression. J. Neurochem.93:749–761.

40.Kuyumcu-Martinez, N. M., M. Joachims, and R. E. Lloyd.2002. Efficient cleavage of ribosome-associated poly(A)-binding protein by enterovirus 3C protease. J. Virol.76:2062–2074.

41.Leffers, H., K. Dejgaard, and J. E. Celis.1995. Characterisation of two major cellular poly(rC)-binding human proteins, each containing three K-homolo-gous (KH) domains. Eur. J. Biochem.230:447–453.

42.Lenk, R., and S. Penman.1979. Cytoskeletal framework and poliovirus metabolism. Cell16:289–301.

43.Lidsky, P. V., S. Hato, M. V. Bardina, A. G. Aminev, A. C. Palmenberg, E. V. Sheval, V. Y. Polyakov, F. J. Van Kuppeveld, and V. I. Agol.2006. Nucleo-cytoplasmic traffic disorder induced by cardioviruses. J. Virol.80:2705–2717. 44.Liebig, H. D., E. Ziegler, R. Yan, K. Hartmuth, H. Klump, H. Kowalski, D. Blaas, W. Sommergruber, L. Frasel, B. Lamphear, R. Rhoads, E. Kuechler, and T. Skern.1993. Purification of two picornaviral 2A proteinases: inter-action with eIF-4 gamma and influence on in vitro translation. Biochemistry 32:7581–7588.

45.Lindquist, J. N., S. G. Kauschke, B. Stefanovic, E. R. Burchardt, and D. A. Brenner.2000. Characterization of the interaction between␣CP2 and the 3⬘-untranslated region of collagen␣1(I) mRNA. Nucleic Acids Res.28: 4306–4316.

on November 8, 2019 by guest

http://jvi.asm.org/

(14)

the viral RNA polymerase domain. J. Biol. Chem.274:12867–12876. 53.Parsley, T. B., J. S. Towner, L. B. Blyn, E. Ehrenfeld, and B. L. Semler.1997.

Poly(rC) binding protein 2 forms a ternary complex with the 5⬘-terminal sequences of poliovirus RNA and the viral 3CD proteinase. RNA3:1124– 1134.

54.Paul, A. V.2002. Possible unifying mechanism of picornavirus genome rep-lication, p. 227–246.InB. L. Semler and E. Wimmer (ed.), Molecular biology of picornaviruses. ASM Press, Washington, D.C.

55.Paul, A. V., J. H. van Boom, D. Filippov, and E. Wimmer.1998. Protein-primed RNA synthesis by purified poliovirus RNA polymerase. Nature393: 280–284.

56.Paulding, W. R., and M. F. Czyzyk-Krzeska.1999. Regulation of tyrosine hydroxylase mRNA stability by protein-binding, pyrimidine-rich sequence in the 3⬘-untranslated region. J. Biol. Chem.274:2532–2538.

57.Porter, F. W., Y. A. Bochkov, A. J. Albee, C. Wiese, and A. C. Palmenberg. 2006. A picornavirus protein interacts with Ran-GTPase and disrupts nucle-ocytoplasmic transport. Proc. Natl. Acad. Sci. USA103:12417–12422. 58.Sanford, J. R., N. K. Gray, K. Beckmann, and J. F. Caceres.2004. A novel

role for shuttling SR proteins in mRNA translation. Genes Dev.18:755–768. 59.Sharma, R., S. Raychaudhuri, and A. Dasgupta.2004. Nuclear entry of poliovirus protease-polymerase precursor 3CD: implications for host cell transcription shut-off. Virology320:195–205.

60.Shiroki, K., T. Isoyama, S. Kuge, T. Ishii, S. Ohmi, S. Hata, K. Suzuki, Y. Takasaki, and A. Nomoto.1999. Intracellular redistribution of truncated La protein produced by poliovirus 3Cpro-mediated cleavage. J. Virol.73:2193–

2200.

8965.

67.Tommerup, N., and H. Leffers.1996. Assignment of human KH-box-con-taining genes by in situ hybridization: HNRNPK maps to 9q21.32-q21.33, PCBP1 to 2p12-p13, and PCBP2 to 12q13.12-q13.13, distal to FRA12A. Genomics32:297–298.

68.Walter, B. L., J. H. Nguyen, E. Ehrenfeld, and B. L. Semler.1999. Differ-ential utilization of poly(rC) binding protein 2 in translation directed by picornavirus IRES elements. RNA5:1570–1585.

69.Walter, B. L., T. B. Parsley, E. Ehrenfeld, and B. L. Semler.2002. Distinct poly(rC) binding protein KH domain determinants for poliovirus translation initiation and viral RNA replication. J. Virol.76:12008–12022.

70.Wang, Z., N. Day, P. Trifillis, and M. Kiledjian.1999. An mRNA stability complex functions with poly(A)-binding protein to stabilize mRNA in vitro. Mol. Cell. Biol.19:4552–4560.

71.Weiss, I. M., and S. A. Liebhaber.1994. Erythroid cell-specific determinants of␣-globin mRNA stability. Mol. Cell. Biol.14:8123–8132.

72.Yalamanchili, P., U. Datta, and A. Dasgupta.1997. Inhibition of host cell transcription by poliovirus: cleavage of transcription factor CREB by polio-virus-encoded protease 3Cpro

. J. Virol.71:1220–1226.

73.Yalamanchili, P., K. Harris, E. Wimmer, and A. Dasgupta.1996. Inhibition of basal transcription by poliovirus: a virus-encoded protease (3Cpro) inhibits

formation of TBP-TATA box complex in vitro. J. Virol.70:2922–2929. 74.Yalamanchili, P., K. Weidman, and A. Dasgupta.1997. Cleavage of

tran-scriptional activator Oct-1 by poliovirus encoded protease 3Cpro. Virology

239:176–185.

on November 8, 2019 by guest

Figure

TABLE 1. Examples of cellular proteins cleaved during picornavirus infections
FIG. 1. PCBP cleavage products accumulate during poliovirus infection of HeLa cells. Crude extracts from mock-infected (lanes 1 to 8) orpoliovirus-infected (lanes 11 to 18) HeLa cells were examined over a 7-h time course by Western blot analysis
FIG. 2. Alignment of the human and mouse PCBP KH3 domain sequences showing putative 3C/3CD cleavage sites
TABLE 2. Cleavage products of PCBP2
+6

References

Related documents

Rather than report the rape, the survivors constructed narratives that direct blame and accountability toward the ‘old self.’ This less visible, yet still agentic strategy, allows

A sparse signal model for radar return from a helicopter was designed and used in conjunction with a greedy sparse signal recovery algorithm to extract the micro-Doppler parameters

GOVT SIDDHA MEDICAL COLLEGE &HOSPITAL DEPARTMENT OF NOI NAADAL A STUDY ON DIAGNOSTIC METHODOLOGY. AND

Shown are the periphery of a virus-infected (A) or mock-infected (B) HeLa cell (particles detectable only with virus-infected cells are indicated with arrows); an

However, because CCR5 and cathepsin S upregulation occurred ;200 days before the onset of clinical disease in the SY-Rat model, early glial activation could have beneficial

HEK293 cells were cotransfected with 1.5 ␮ g each of expression vectors for HIV-1 envelope protein (pdl1443), amphotropic MLV envelope protein (pCAETr) (Ampho MLV), or VSV-G

The popular and efficient FastICA algorithm is applied to patches of leaf images to learn a set of linear basis functions or features for the images and then the

infrazygoma Fat Injection Buttock 50 Edema Nil 11 Ramya 20 Female 2121 Developmental deformity left chin Fat Injection Abdomen 76 - Nil 12 Srinivasan 28 Male 2102