• No results found

Use of Resequencing Oligonucleotide Microarrays for Identification of Streptococcus pyogenes and Associated Antibiotic Resistance Determinants

N/A
N/A
Protected

Academic year: 2020

Share "Use of Resequencing Oligonucleotide Microarrays for Identification of Streptococcus pyogenes and Associated Antibiotic Resistance Determinants"

Copied!
6
0
0

Loading.... (view fulltext now)

Full text

(1)

0095-1137/05/$08.00⫹0 doi:10.1128/JCM.43.11.5690–5695.2005

Use of Resequencing Oligonucleotide Microarrays for Identification

of

Streptococcus pyogenes

and Associated Antibiotic

Resistance Determinants‡

Louis Davignon,

1

Elizabeth A. Walter,

2,3

Kate M. Mueller,

4

Christopher P. Barrozo,

5

David A. Stenger,

6

and Baochuan Lin

6

* on behalf of the

Epidemic Outbreak Surveillance Consortium†

Malcolm Grow Medical Center, Andrews Air Force Base, Maryland 207621; Epidemic Outbreak Surveillance Advanced Diagnostics

Laboratory, Lackland Air Force Base, San Antonio, Texas 782362; Texas A&M University Systems, San Antonio, Texas 782233;

Nova Research Inc., Alexandria, VA 223084; DoD Center for Deployment Health Research, Naval Health Research Center,

San Diego, California 921525; and Center for Bio/Molecular Science & Engineering, Code 6900,

Naval Research Laboratory, Washington, DC 203756

Received 25 February 2005/Returned for modification 19 May 2005/Accepted 15 August 2005

Group A streptococci (GAS) are responsible for a wide variety of human infections associated with consid-erable morbidity and mortality. Ever since the first systematic effort by Lancefield to group Streptococcus

species by M protein variants, the detection and characterization ofStreptococcusby different methods have been an evolving process. The ideal assay for GAS identification not only would provide quick and accurate diagnostic results but also would reveal antibiotic resistance patterns and genotype information, aiding not only in treatment but in epidemiologic assessment as well. The oligonucleotide microarray is a promising new technology which could potentially address this need. In this study, we evaluated the usefulness of oligonu-cleotide resequencing microarrays for identifying GAS and its associated antibiotic resistance markers. We demonstrated an assay platform that combines the use of resequencing DNA microarrays with either random nucleic acid amplification or multiplex PCR for GAS detection. When detectingStreptococcus pyogenesfrom coded clinical samples, this approach demonstrated an excellent concordance with a more established culture method. To this end, we showed the potential of resequencing microarrays for efficient and accurate detection of GAS and its associated antibiotic resistance markers with the benefit of sequencing information from microarray analysis.

Streptococcus pyogenes, one of the most important human bacterial pathogens, causes a variety of diseases, such as phar-yngitis (strep throat), scarlet fever, and impetigo, etc. In

addi-tion,S. pyogenesis responsible for a number of nonsuppurative

sequelae, such as acute rheumatic fever, acute glomerulone-phritis, and reactive arthritis (6, 15, 24, 25). Extremely

preva-lent,S. pyogeneshas been the source of numerous outbreaks of

pharyngitis at military installations and college campuses,

mak-ing early detection of the organism an important epidemiologic

concern. Complicating the treatment ofS. pyogenesfurther is

the increasing incidence of erythromycin resistance as docu-mented by the PROTEKT surveillance group (3).

The traditional microbial diagnosis ofS. pyogenesrelied on a

throat culture that appeared as beta-hemolytic colonies on 5% sheep blood agar (6). The considerable lag time (24 to 48 h) for throat cultures could result in delayed diagnosis, deferred

treat-* Corresponding author. Mailing address: Center for Bio/Molec-ular Science & Engineering, Code 6900, Naval Research Laboratory, Washington, DC 20375. Phone: (202) 767-0289. Fax: (202) 767-9594. E-mail: [email protected].

† The Epidemic Outbreak Surveillance Consortium is an Air Force Medical Service initiative. The following are participating members of the EOS Consortium: (i) sponsorship, Peter F. Demitry (USAF/SGR) and Theresa Lynn Difato (USAF/SGR); (ii) executive board and prin-cipal investigators, Eric H. Hanson (The George Washington Univer-sity [IPA]), Rosana R. Holliday (USAF/SGR [Ctr]), Robb K. Rowley (The George Washington University [IPA]), and Clark Tibbetts (The George Washington University [IPA]); (iii) operational board and senior scientists, Brian K. Agan (Wilford Hall Medical Center), Jerry Diao (USAF/SGR [Ctr]), Russell P. Kruzelock (Virginia Tech [IPA]), David A. Stenger (Naval Research Laboratory), and Elizabeth A. Walter (Texas A&M University Systems San Antonio [IPA]); (iv) technical advisors and collaborating investigators, Luke Daum (Air Force Institute for Operational Health), David Metzgar (Navy Health Research Center), Debra Niemeyer (USAF/SGR), and Kevin Rus-sell (Navy Health Research Center); (v) research and clinical staff, Marie J. Archer (Naval Research Laboratory), Roger Bravo

(Lack-land AFB, Tex.), Nikki Freed (Naval Health Research Center), Julie Fuller (Naval Health Research Center), John Gomez (Lack-land AFB, Tex.), Kevin Gratwick (Naval Health Research Center), Michael Jenkins (Wilford Hall Medical Center), Margaret Jesse (Lackland AFB, Tex.), Barry Johnson (Lackland AFB, Tex.), Erin Lawrence (Naval Health Research Center), Baochuan Lin (Naval Research Laboratory), Carolyn E. Meador (NOVA Research In-corporated), Hernan Melgarejo (Lackland AFB, Tex.), Kate M. Mueller (NOVA Research Incorporated), Chris Olsen (USAF/SGR [Ctr]), David Pearson (Lackland AFB, Tex.), Anjan Purkayastha (USAF/SGR [Ctr]), Jose J. Santiago (Lackland AFB, Tex.), Donald Seto (George Mason University [IPA]), Francine Fuentes Stotler (Lackland AFB, Tex.), Dzung Thach (Naval Research Laboratory), Jennifer A. Thornton (NOVA Research Incorporated), Zheng Wang (Naval Research Laboratory), Daisy Watson (Lackland AFB, Tex.), Sue A. Worthy (Lackland AFB, Tex.), and Gary J. Vora (Naval Research Laboratory); and (vi) operations support staff, Kenya Grant (USAF/SGR [Ctr]), Cheryl J. James (USAF/SGR [Ctr]), and Kathy Word (USAF/SGR [Ctr]).

‡ Supplemental material for this article may be found at http://jcm .asm.org/.

5690

on May 15, 2020 by guest

http://jcm.asm.org/

(2)

ments, and decreased compliance (5). Rapid detection of group A streptococci (GAS) offers several advantages, such as providing earlier and appropriate treatment, decreasing transmission, and reducing symptom duration and suppurative complications, and is preferred by patients and physicians if the diagnosis can be made on the same day and antibiotic therapy can be provided immedi-ately (5, 31). Rapid diagnostic tests, such as antigen tests, have evolved during the last 20 years to become more sensitive (in the range of 70 to 95% compared with the culture method). However, studies have shown that there still are substantial false-negative rates with rapid antigen testing, and a controversy exists regarding whether or not these rapid tests require a confirmatory assay(s) when the result is negative (5, 12, 30, 31). Further, Johnson et al. reported that false-positive rapid antigen detection caused by cross-reactive organisms may be more common than previously reported (17).

With the advancement of molecular techniques, the last 10 years have seen increasing emphasis on molecular diagnosis using PCR-based assays (2). PCR-based assays resulting in rapid amplification of the bacterial genome are the mainstay of new analysis methods, including Vir typing using restriction fragment length polymorphism (RFLP), fluorescent RFLP, PCR M typing, immuno-PCR, and real-time PCR (9, 14, 22, 24, 35, 36). Although PCR-based methods have clearly facili-tated the detection of GAS, these detection techniques require multistep procedures and special laboratory setups and are subject to equivocal results.

With substantial progress in microarray technology, it is now possible to combine the sensitivity afforded by nucleic acid amplification with the specificity afforded by DNA-DNA hy-bridization for the detection of human pathogens (4, 16, 19–21, 28, 29, 37). Recently, high-density microarrays with resequenc-ing capability have been used to identify pathogen species and drug resistance in a series of in vitro experiments using cul-tured microorganisms, including human immunodeficiency

vi-rus, mycobacteria, and rifampin-resistantMycobacterium

tuber-culosis strains (13, 20, 34). More recently, sequence-specific

identification of Francisella tularensis and Yersinia pestis was

demonstrated in environmental samples with high-density mi-croarrays with resequencing capability (39, 40).

We have previously described an Affymetrix resequencing respiratory pathogen microarray (RPM v.1) for simultaneous

detection and characterization of the many different types of respiratory tract pathogens that cause common diseases with similar clinical symptoms (Lin et al., submitted for publica-tion). RPM v.1 consists of prototype regions for the detection of human adenoviruses, influenza A virus (subtypes H1, H3, H5, N1, and N2), 12 other common respiratory pathogens (influenza B virus, parainfluenza virus, rhinovirus, respiratory

syncytial virus, West Nile virus, coronavirus, Streptococcus

pneumoniae, Streptococcus pyogenes, Mycobacterium pneumo-niae,Neisseria meningitidis,Bordetella pertussis, andChlamydia pneumoniae), and six Centers for Disease Control and

Preven-tion category A bioterrorism pathogens (Bacillus anthracis,

variola major virus, Ebola virus, Lassa virus,Francisella

tula-rensis, andYersinia pestis) known to cause febrile respiratory illness (i.e., “flu-like” symptoms). We demonstrated that we could unequivocally detect and type both DNA and RNA viruses from clinical samples as well as validate each tiled sequence on the RPM v.1 (with the exception of West Nile virus) using clinical and/or controlled laboratory samples (Lin et al., submitted for publication). Building on this foundation, a more comprehensive study was undertaken to evaluate the

use of resequencing arrays for the detection ofS. pyogenesand

associated antibiotic resistance markers.

MATERIALS AND METHODS

PrototypeStreptococcus pyogenesand erythromycin-resistant markers. Proto-typeStreptococcus pyogenes(strain MGAS 8232) was obtained from the Amer-ican Type Culture Collection (Manassas, VA). The PCR controls for erythro-mycin-resistant markers,erm(B),erm(TR), andmef, were amplified by PCR and cloned into TOPO PCR 2.1 vector (Invitrogen Life Technologies, Carlsbad, CA). All clones were verified by sequencing.

Primer design and PCR amplification.The primers used for PCR are listed in Table 1. PCRs were performed in 25-␮l volumes containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2 mM MgCl2, 200 ␮M each of the deoxynucleoside triphosphates (dNTPs), 200 to 300 nM primers, 1 U of PlatinumTaqDNA polymerase (Invitrogen Life Technologies, Carlsbad, CA), and 1␮l of purified DNA template from clinical samples. The amplification reaction was carried out in Peltier PTC225 thermal cycler (MJ Research Inc., Reno, NV) with preliminary denaturation at 94°C for 3 min; followed by 40 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 40 s; and a final extension at 72°C for 10 min. The amplified products were electrophoresed on 2.5 to 3% Tris-acetate-EDTA (TAE) agarose gels and visualized by ethidium bromide staining. PCRs for GAS detection were carried out as previously described (18).

[image:2.585.46.542.80.239.2]

Random amplification strategy.Random amplification for DNA samples was carried out with bacteriophage␾29 DNA polymerase with random hexamers TABLE 1. Oligonucleotide primers used for real-time PCR and multiplex PCR

Primer Gene product Sequence (5⬘33⬘) Amplicon size in

bp (reference)

Spy MF F Mitogenic factor CTACTTGGATCAAGACGGGT 419 (18)

Spy MF R TTAGGGTTTCCAGTCCATCC

SpeB F1 Pyrogenic exotoxin B (speB) GTCAACATGCAGCTACAGGA 257 (24)

SpeB R1 AATACCAACATCAGCATCA

ermB F1 Erythromycin resistance methylase [erm(B)] GTAAACAGTTGACGATATTCTCG 224 (26)

ermB R1 CGTACCTTGGATATTCACCG

ermTR F1 Erythromycin resistance methylase [erm(TR)] GCTATAGAGATTGATGAAGG 152 (11)

ermTR R1 CTAATATTGTAGGGAATATTACC

mefF1 Macrolide-efflux determinant (mefA, mefE) AGTATCATTAATCACTAGTGC 346 (33)

mefR1 TTCTTCTGGTACTAAAAGTGG

on May 15, 2020 by guest

http://jcm.asm.org/

(3)

that was performed according to the instructions of the GenomiPhi DNA am-plification kit (Amersham Biosciences Corp., Sunnyvale, CA). The amplified products were ethanol precipitated according to the manufacturer’s recom-mended protocol.

Clinical samples.Throat swabs were collected by the Respiratory Disease Laboratory-Naval Health Research Center (NHRC) from patients with acute respiratory disease symptoms and immediately placed in 2-ml cryogenic vials containing 1.5 ml of transport medium. Nasal washes from the Epidemic Out-break Surveillance (EOS) team at Lackland Air Force Base were collected from basic military trainees with acute respiratory disease symptoms. In both in-stances, samples were tested at the site of collection using conventional culture techniques and submitted for microarray-based detection in a masked fashion. GAS-positive samples were identified among culture plates by colony morphol-ogy (beta-hemolytic colonies) on 5% sheep blood agar plates after 24 h of incubation. Beta-hemolytic colonies were confirmed to be GAS by susceptibility to bacitracin and a positive reaction to the latex agglutination test (Hardy Di-agnostics, Santa Maria, CA). The collection and transport of all clinical samples complied with the Wilford Hall Medical Center protocol for clinical investigation (FWH20020124H). Nucleic acid was extracted from clinical samples using the MasterPure DNA purification kit (Epicenter Technologies, Madison, WI) fol-lowing the manufacturer’s recommended protocol with slight modification. We omitted the RNase digestion step. Informed consent was obtained from all participants after the nature and possible consequences of the studies were explained.

Microarray hybridization and processing.Nucleic acids of clinical samples were subjected to either multiplex PCR or random amplification. The amplified products were fragmented and labeled according to the recommended protocol by Affymetrix (Santa Clara, CA) prior to hybridization. Microarray hybridization and processing were carried out according to the manufacturer’s recommended protocol (Af-fymetrix, Santa Clara, CA). After scanning, the GCOS software is used to reduce the raw image (.DAT) file to a simplified file format (.CEL file) with intensities assigned to each of the corresponding probe positions. Finally, the GDAS software is used to apply an embedded version of the ABACUS algorithm (7) to produce an estimate of the correct base calls, comparing the respective intensities for the sense and antisense probe sets. To increase the percentage of base calls, we adjusted the parameters to allow highly permissive base calls (increased percentage) as described previously (supplemental material). The sequences from base calls made for each tiled region of the resequencing array then were exported from GDAS as the FASTA-formatted files. Resequencing pathogen identification (REPI) software was used to parse the output of the FASTA file into a format suitable for sequence similarity searches using the NCBI BLASTN algorithm (J. A. Thornton, 2004, U.S. patent application).

RESULTS

Gene selection for microarray fabrication.Two major crite-ria were used for the sequence selection to be tiled on RPM v.1: pathogenicity-related genes and drug resistance genes. For

pathogenicity-related genes, the gene coding forS. pyogenes

exotoxin B, which is a chromosomally carried structural gene

(speB), was selected. speB is associated with pyrogenicity,

T-lymphocyte mitogenicity, and the ability to increase

suscepti-bility to endotoxic shock in individuals infected with S.

pyo-genes. The conserved and stable feature of speB and its presence in almost all GAS make it a good target gene for

Streptococcusidentification (6, 24). In addition to pathogenic-ity-related genes, rapid increasing antimicrobial resistance in

S. pneumoniae and S. pyogenes is of major clinical concern.

WhileS. pyogenesremains susceptible to penicillin G, in

pa-tients with␤-lactam-associated allergies or treatment failure,

macrolides are the treatment of choice. However, the increas-ing incidence of macrolide resistance in GAS has become an issue (3). Due to the increasing concern about erythromycin resistance in GAS, three genes were chosen as targets for identification of erythromycin-resistant markers. Macrolide re-sistance in streptococci occurs predominantly by two mecha-nisms. (i) The first is target modification, whereby a specific

adenine residue on the 23S rRNA is methylated. Two different

erm (erythromycin ribosome methylation) methylase genes,

erm(B) and erm(A) (TR variant), are the most common in

S. pyogenes(11). (ii) The second mechanism is antibiotic efflux,

whereby macrolide efflux (mef) is facilitated by Mef protein (8,

11, 26, 27, 33). Thus,erm(B),erm(TR), andmefwere chosen as

target genes used as a tiled sequence on RPM v.1. (For probe information about RPM v.1, see Table S1 in the supplemental material.)

Multiplex PCR versus random amplification.In developing microarray technology for identifying pathogens, front-end amplification is required to reach low levels of detection sen-sitivity without culturing the organisms (23). Two different amplification strategies, multiplex PCR and random amplifi-cation, were used as front-end amplification for GAS identifi-cation prior to hybridization to RPM v.1 chips. PCR or mul-tiplex PCR is the most commonly employed front-end amplification method with microarrays for detection of

patho-gens. In this study, four sets of primers [speB, erm(B),

erm(TR), andmefgenes; Table 1], which we selected for

de-tectingS. pyogenesas well as its antibiotic resistance markers

on RPM v.1 chips, were combined in a single multiplex PCR assay and evaluated under various conditions to obtain ampli-fication of all four target genes. The PCR products were ver-ified by 2.5 to 3% TAE agarose gel electrophoresis (data not shown). The capability of the resequencing microarray to de-tect GAS was tested using RPM v.1 to interrogate PCR

am-plicons from prototypeS. pyogenes(strain MGAS 8232).

Pri-mary sequence data generated by the hybridization revealed

that RPM v.1 unequivocally identifies prototype S. pyogenes

(strain MGAS 8232) without erythromycin resistance markers. In addition to multiplex PCR, we successfully demonstrated random amplification provides great utilities for the purpose of broad-spectrum respiratory pathogen surveillance. It combines the use of resequencing DNA microarrays with methods for microbial nucleic acid enrichment, random nucleic acid ampli-fication, and automated sequence similarity searching for pathogen detection (Lin et al., submitted for publication). Sim-ilar data were observed when hybridizing randomly amplified

nucleic acid from prototypeS. pyogenes(strain MGAS 8232) to

RPM v.1. Both PCR and random amplification achieved nearly identical levels of hybridization specificity (data not shown), with PCR showing higher sensitivity. Figure 1A shows a

rep-resentative hybridization pattern of one of the S. pyogenes

-positive clinical samples. The sequence information derived from GDAS base-calling algorithm (Fig. 1B and C) was used to query a database using a similarity search algorithm with REPI software (Fig. 1C), which was developed in our laboratory. Proof-of-concept experiments, utilizing clinical samples ob-tained from patients presenting GAS-induced illness, unequiv-ocally demonstrated the ability of RPM v.1 chips for correct species and antibiotic marker identification.

RPM v.1 forS. pyogenesdetection in clinical samples.After successfully demonstrating the utility of the RPM v.1 chip for

GAS identification, clinical samples (n⫽35; 22 throat swabs,

13 nasal washes) collected from the NHRC and EOS team at Lackland Air Force Base were used to assess and compare the utility of the microarray-based diagnostic to more established

methods ofS. pyogenesdetection—culture and/or PCR (18).

The comparison demonstrated a concordance for 18 of 19

on May 15, 2020 by guest

http://jcm.asm.org/

(4)

samples. Two clinical samples that were negative forS. pyo-genesby conventional methods (culture and/or PCR) also were not detected in our microarray analysis (Table 2). Further-more, RPM v.1 chip results identified antibiotic-resistant markers simultaneously without further testing, thus demon-strating an additional benefit of this assay. In addition, we

identified eightS. pneumoniae-positive, sixB. pertussis-positive,

and two adenovirus-positive samples out of the same sample set with a random amplification strategy (see Table S2 in the supplemental material). The disagreement over the one sample in GAS identification may have resulted from the dif-ference in sensitivity and specificity of the methods. Our data demonstrate the ability of the microarray-based diagnostic to

correctly identifyS. pyogenesin a manner consistent with the

conventional “gold standard” culture method (Table 3). Also, this result showed no cross-reactivity among different patho-gens and demonstrated the great specificity of the assay. The accuracy of RPM v.1 chips for sequence-specific pathogen de-tection was further validated using clinical and/or controlled laboratory samples (with the exception of West Nile virus); no false-positive results were obtained due to microarray base call or analysis errors (Lin et al., submitted for publication). Fur-thermore, a nonbiased random amplification strategy with the sequencing capability of RPM v.1 chips promised the great potential of using this assay for broader-spectrum surveillance purposes.

DISCUSSION

The purpose of this study was to evaluate the use of

rese-quencing microarray for diagnosis ofS. pyogenes and

[image:4.585.300.541.89.300.2]

associ-FIG. 1. Representative RPM v.1 chip image of GAS-positive clin-ical sample. (A)S. pyogenes-positive clinical sample hybridized to RPM v.1 chip following nucleic acid isolation and amplification using mul-tiplex PCR primers. No significant cross-hybridization is observed. (B) Hybridization-based primary sequences generated through the chip image. GDAS software is used to apply an embedded version of the ABACUS (7) algorithm to produce an estimate of the correct base calls, comparing the respective intensities for the sense and antisense probe sets. (C) FASTA sequence output file and REPI analysis result ofS. pyogenesshowing the highest BLAST bit score across all respec-tive tile regions where amplicons hybridized.

TABLE 2. Comparison of resequencing microarray to culture results forS. pyogenes-positive clinical samples

Sample Sample type RPM v.1 result

Result bya:

Culture PCR

NHRC 7 Throat swab speB ⫹ ⫹

NHRC 9 Throat swab speB

NHRC 11 Throat swab speB ⫹ ⫹

NHRC 13 Throat swab speB erm(TR)

NHRC 15 Throat swab speB erm(B) ⫹ ⫹

NHRC 17 Throat swab speB

NHRC 19 Throat swab speB erm(TR) ⫹ ⫹

NHRC 21 Throat swab speB erm(TR)

097881 Nasal wash speB erm(TR) ⫹ ⫹

114071 Nasal wash speB erm(B)erm(TR)mef 532599 Nasal wash speB erm(B)erm(TR) ⫹ ⫹ 760937 Nasal wash speB erm(B)erm(TR)mef 796169 Nasal wash speB erm(B)erm(TR) ⫹ ⫹ 808433 Nasal wash speB erm(B)erm(TR) 865041b Nasal wash speB erm(B)erm(TR)mef ND

910664 Nasal wash speB erm(B)erm(TR) ND 971508 Nasal wash speB erm(B)erm(TR) ⫹ ⫹

889873 Nasal wash ND ⫺

246517 Nasal wash ND ⫺

a

PCRs for GAS detection were carried out as previously described (18). ND, not done.

b

[image:4.585.297.542.656.725.2]

The only discordant sample identified by various methods.

TABLE 3. Evaluation of RPM v.1 forS. pyogenesdetection in clinical samples

RPM v.1 result

No. of samples with result by:

Throat swab Nasal wash

Culture⫹ Culture⫺ Culture⫹ Culture⫺

⫹ 8 0 8 1

⫺ 0 0 2 2

on May 15, 2020 by guest

http://jcm.asm.org/

(5)

ated antibiotic-resistant markers. In this study, we demon-strated that the combination of either PCR or random amplification with Affymetrix resequencing RPM v.1 allows for

accurate detection ofS. pyogeneswith the additional benefit of

identifying associated antibiotic markers from microarray anal-ysis. The ability to identify antibiotic resistance markers with-out further assays demonstrated the great potential of the resequencing microarray as an aid in treatment without em-pirical antibiotic therapy. Also, this approach will assist epide-miological assessment of the spatial and temporal distribution of resistance genes. In addition, the sequencing capability of the resequencing microarray provides genotyping information which will greatly aid in epidemiologic surveillance.

It is important that the new assay provide a cost-effective alternative to conventional approaches to the diagnosis, man-agement, and surveillance of infectious diseases, most partic-ularly respiratory infections. In the current format, the RPM

v.1 assay is not yet optimized for speed (⬃12 to 24 h) or cost

(400 U.S. dollars per chip, approximately 20 U.S. dollars per pathogen species) relative to those desired for rapid infectious disease diagnostics. However, the approach is highly amenable to improvement via reduction in array size (i.e., lower cost), process automation, and the availability of portable hardware for processing resequencing arrays. In the event of lower-cost or easily automated microarray alternatives, the resequencing array can be a higher-echelon component in a diagnostics/ surveillance pipeline. With this objective in mind, we are cur-rently working on developing automated technologies that will enable for point-of-care diagnostics applications using rese-quencing microarray technologies.

Since the mid-1980, incidents ofS. pyogenesinfection have

been on the rise and have been associated with life-threatening diseases (6). Genotyping is essential for GAS outbreak inves-tigation and surveillance. Traditional typing methods, such as serologic typing methods, rely on available antisera and often produce ambiguous results (2, 6). Recently, molecular typing methods, such as PCR M typing (PCR with rapid sequencing), PCR–enzyme-linked immunosorbent assay, and sequencing, Vir typing using RFLP, and fluorescent RFLP (2, 8, 9, 14, 21, 31, 32) have provided sensitive alternative methods. Despite the sensitivity and specificity associated with molecular typing methods, these methods are often limited to targeting one gene for genotyping purpose. With resequencing microarrays, we could target more than one gene for diagnostic and geno-typing purposes, which will provide more accurate genogeno-typing information for surveillance.

We choose thespeBgene, coding for a cysteine proteinase

produced by all group A streptococci, as the target gene for

S. pyogenesdetection on Affymetrix RPM v.1 due to its con-served and stable characteristics (24). Though useful in detect-ingS. pyogenes, the sequences obtained from microarrays do not provide enough genotype information for epidemiological

assessment.S. pyogenes strains are commonly categorized by

antigenic differences in M protein, a transmembrane surface protein that is also a crucial virulence factor (1). M protein is

encoded by theemmgene ofS. pyogenes. The 5⬘ends of the

emmgene are hypervariable and code for serotype specificity

for more than 80 distinct serotypes (10). Due to the size lim-itation of RPM v.1 “real estate,” the RPM v.1 group A strep-tococcus genotyping capability was not fully explored in this

study. Nonetheless, this study showed the potential of using a resequencing microarray for genotyping group A streptococci

in future studies. Indeed, we included M protein (emmgenes)

in version 2 resequencing microarrays, which will enable us to detect and provide serotype information of GAS in future studies. Although not commonly considered a bioterror agent, outbreaks of streptococcal pharyngitis are common in military barracks. With the increasing prevalence of antibiotic resis-tance documented worldwide by the PROTEKT surveillance group (3) and with the increased deployment tempo of the U.S. military, the potential importance of rapid identification

of emerging resistance becomes obvious. Three genes,erm(B),

erm(TR), andmef, were chosen as targets for identification of

erythromycin resistance markers. The primers used for ampli-fying these genes have been used successfully in surveying erythromycin resistance mechanisms with PCR-based assays (11, 26, 30). In this study, we successfully adapted the ampli-fication strategy and expanded the direct sequencing capability of amplified PCR products with a resequencing microarray. The sequence information yielded can be used for comparison with available sequences in database. However, the present study did not generate sufficient sequence information (ampli-cons are too small) to reach a general conclusion about the specificity of the antibiotic resistance markers. Nonetheless, this method proved that the resequencing microarray-based assay can be expanded to include longer sequences for future study and provide more specific answers for antibiotic resis-tance markers.

In summary, we have demonstrated the potential of rese-quencing microarrays for efficient and accurate detection of GAS with the benefit of sequencing information from microar-ray analysis. With this method, we are able to show the capa-bility of the resequencing microarray to provide unequivocal

means for detectingS. pyogenesand its associated

antibiotic-resistant markers. With further improvement of gene selection, we should be able to provide genotyping information of

S. pyogenesand improve the specificity of antibiotic markers in future studies.

ACKNOWLEDGMENTS

Support for research efforts of the EOS was provided by the Defense Threat Reduction Agency, the United States Army Medical Materiel Research Command, the Air Force Medical Service (Office of HQ USAF Surgeon General), and the Office of Naval Research. We also thank the Naval Health Research Center (Respiratory Disease Labo-ratory) for providing clinical samples.

The opinions and assertions contained herein are those of the au-thors and are not to be construed as official or reflecting the views of the Department of Defense or the U.S. Government.

REFERENCES

1.Banks, D. J., S. B. Beres, and J. M. Musser.2002. The fundamental contri-bution of phages to GAS evolution, genome diversification and strain emer-gence. Trends Microbiol.10:515–521.

2.Beall, B., R. Facklam, and T. Thompson.1996. Sequencingemm-specific PCR products for routine and accurate typing of group A streptococci. J. Clin. Microbiol.34:953–958.

3.Canton, R., E. Loza, M. I. Morosini, and F. Baquero.2002. Antimicrobial resistance amongst isolates of Streptococcus pyogenesandStaphylococcus aureus in the PROTEKT antimicrobial surveillance programme during 1999–2000. J. Antimicrob. Chemother.50(Suppl. 1):9–24.

4.Chizhikov, V., M. Wagner, A. Ivshina, Y. Hoshino, A. Z. Kapikian, and K. Chumakov.2002. Detection and genotyping of human group A rotaviruses by oligonucleotide microarray hybridization. J. Clin. Microbiol.40:2398– 2407.

on May 15, 2020 by guest

http://jcm.asm.org/

(6)

5.Corneli, H. M.2004. Rapid detection and diagnosis of group A streptococcal pharyngitis. Curr. Infect. Dis. Rep.6:181–186.

6.Cunningham, M. W.2000. Pathogenesis of group A streptococcal infections. Clin. Microbiol. Rev.13:470–511.

7.Cutler, D. J., M. E. Zwick, M. M. Carrasquillo, C. T. Yohn, K. P. Tobin, C. Kashuk, D. J. Mathews, N. A. Shah, E. E. Eichler, J. A. Warrington, and A. Chakravarti.2001. High-throughput variation detection and genotyping us-ing microarrays. Genome Res.11:1913–1925.

8.Del Grosso, M., F. Iannelli, C. Messina, M. Santagati, N. Petrosillo, S. Stefani, G. Pozzi, and A. Pantosti.2002. Macrolide efflux genesmef(A) and mef(E) are carried by different genetic elements in Streptococcus pneu-moniae. J. Clin. Microbiol.40:774–778.

9.Desai, M., A. Efstratiou, R. George, and J. Stanley.1999. High-resolution genotyping of Streptococcus pyogenesserotype M1 isolates by fluorescent amplified-fragment length polymorphism analysis. J. Clin. Microbiol. 37: 1948–1952.

10.Facklam, R., B. Beall, A. Efstratiou, V. Fischetti, D. Johnson, E. Kaplan, P. Kriz, M. Lovgren, D. Martin, B. Schwartz, A. Totolian, D. Bessen, S. Holl-ingshead, F. Rubin, J. Scott, and G. Tyrrell.1999. emm typing and validation of provisional M types for group A streptococci. Emerg. Infect. Dis.5:247– 253.

11.Farrell, D. J., I. Morrissey, S. Bakker, and D. Felmingham.2001. Detection of macrolide resistance mechanisms inStreptococcus pneumoniaeand Strep-tococcus pyogenesusing a multiplex rapid cycle PCR with microwell-format probe hybridization. J. Antimicrob. Chemother.48:541–544.

12.Gieseker, K. E., T. Mackenzie, M. H. Roe, and J. K. Todd.2002. Comparison of two rapidStreptococcus pyogenesdiagnostic tests with a rigorous culture standard. Pediatr. Infect. Dis. J.21:922–927.

13.Gingeras, T. R., G. Ghandour, E. Wang, A. Berno, P. M. Small, F. Drobniewski, D. Alland, E. Desmond, M. Holodniy, and J. Drenkow.1998. Simultaneous genotyping and species identification using hybridization pat-tern recognition analysis of generic Mycobacterium DNA arrays. Genome Res.8:435–448.

14.Hartas, J., M. Hibble, and K. S. Sriprakash.1998. Simplification of a locus-specific DNA typing method (Vir typing) ofStreptococcus pyogenes. J. Clin. Microbiol.36:1428–1429.

15.Hoe, N. P., K. E. Fullerton, M. Liu, J. E. Peters, G. D. Gackstetter, G. J. Adams, and J. M. Musser.2003. Molecular genetic analysis of 675 group A streptococcus isolates collected in a carrier study at Lackland Air Force Base, San Antonio, Texas. J. Infect. Dis.188:818–827.

16.Hwang, T. S., J. K. Jeong, M. Park, H. S. Han, H. K. Choi, and T. S. Park. 2003. Detection and typing of HPV genotypes in various cervical lesions by HPV oligonucleotide microarray. Gynecol. Oncol.90:51–56.

17.Johnson, D. R., and E. L. Kaplan.2001. False-positive rapid antigen detec-tion test results: reduced specificity in the absence of group A streptococci in the upper respiratory tract. J. Infect. Dis.183:1135–1137.

18.Kaltwasser, G., J. Diego, P. L. Welby-Sellenriek, R. Ferrett, M. Caparon, and G. A. Storch.1997. Polymerase chain reaction for Streptococcus pyo-genes used to evaluate an optical immunoassay for the detection of group A streptococci in children with pharyngitis. Pediatr. Infect. Dis. J.16:748–753. 19.Kawaguchi, K., S. Kaneko, M. Honda, H. F. Kawai, Y. Shirota, and K. Kobayashi.2003. Detection of hepatitis B virus DNA in sera from patients with chronic hepatitis B virus infection by DNA microarray method. J. Clin. Microbiol.41:1701–1704.

20.Kozal, M. J., N. Shah, N. Shen, R. Yang, R. Fucini, T. C. Merigan, D. D. Richman, D. Morris, E. Hubbell, M. Chee, and T. R. Gingeras.1996. Ex-tensive polymorphisms observed in HIV-1 clade B protease gene using high-density oligonucleotide arrays. Nat. Med.2:753–759.

21.Lapa, S., M. Mikheev, S. Shchelkunov, V. Mikhailovich, A. Sobolev, V. Blinov, I. Babkin, A. Guskov, E. Sokunova, A. Zasedatelev, L. Sandakhchiev, and A. Mirzabekov.2002. Species-level identification of orthopoxviruses with an oligonucleotide microchip. J. Clin. Microbiol.40:753–757.

22.Liang, H., S. E. Cordova, T. L. Kieft, and S. Rogelj.2003. A highly sensitive immuno-PCR assay for detecting group A streptococcus. J. Immunol. Meth-ods279:101–110.

23.Lopez, M. M., E. Bertolini, A. Olmos, P. Caruso, M. T. Gorris, P. Llop, R.

Penyalver, and M. Cambra.2003. Innovative tools for detection of plant pathogenic viruses and bacteria. Int. Microbiol.6:233–243.

24.Louie, L., A. E. Simor, M. Louie, A. McGeer, and D. E. Low.1998. Diagnosis of group A streptococcal necrotizing fasciitis by using PCR to amplify the streptococcal pyrogenic exotoxin B gene. J. Clin. Microbiol.36:1769–1771. 25.Mandell, G. L., J. E. Bennett, and R. Dolin (ed.). 2000. Principles and

practice of infectious diseases, 5th ed. Churchill Livingstsone, New York, N.Y.

26.Nagai, K., Y. Shibasaki, K. Hasegawa, T. A. Davies, M. R. Jacobs, K. Ubukata, and P. C. Appelbaum.2001. Evaluation of PCR primers to screen forStreptococcus pneumoniaeisolates and beta-lactam resistance, and to detect common macrolide resistance determinants. J. Antimicrob. Che-mother.48:915–918.

27.Roberts, M. C., J. Sutcliffe, P. Courvalin, L. B. Jensen, J. Rood, and H. Seppala. 1999. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob. Agents Chemother. 43:2823–2830.

28.Roth, S. B., J. Jalava, O. Ruuskanen, A. Ruohola, and S. Nikkari.2004. Use of an oligonucleotide array for laboratory diagnosis of bacteria responsible for acute upper respiratory infections. J. Clin. Microbiol.42:4268–4274. 29.Sachse, K., H. Hotzel, P. Slickers, T. Ellinger, and R. Ehricht.2005. DNA

microarray-based detection and identification of Chlamydia and Chlamy-dophila spp. Mol. Cell Probes19:41–50.

30.Santos, O., L. L. Weckx, A. C. Pignatari, and S. S. Pignatari.2003. Detection of group A beta-hemolytic Streptococcus employing three different detection methods: culture, rapid antigen detecting test, and molecular assay. Braz. J. Infect. Dis.7:297–300.

31.Sheeler, R. D., M. S. Houston, S. Radke, J. C. Dale, and S. C. Adamson. 2002. Accuracy of rapid strep testing in patients who have had recent strep-tococcal pharyngitis. J. Am. Board Fam. Pract.15:261–265.

32.Smoot, J. C., K. D. Barbian, J. J. Van Gompel, L. M. Smoot, M. S. Chaussee, G. L. Sylva, D. E. Sturdevant, S. M. Ricklefs, S. F. Porcella, L. D. Parkins, S. B. Beres, D. S. Campbell, T. M. Smith, Q. Zhang, V. Kapur, J. A. Daly, L. G. Veasy, and J. M. Musser.2002. Genome sequence and comparative microarray analysis of serotype M18 group A Streptococcus strains associ-ated with acute rheumatic fever outbreaks. Proc. Natl. Acad. Sci. USA 99:4668–4673.

33.Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack.1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Che-mother.40:2562–2566.

34.Troesch, A., H. Nguyen, C. G. Miyada, S. Desvarenne, T. R. Gingeras, P. M. Kaplan, P. Cros, and C. Mabilat.1999.Mycobacteriumspecies identification and rifampin resistance testing with high-density DNA probe arrays. J. Clin. Microbiol.37:49–55.

35.Uhl, J. R., S. C. Adamson, E. A. Vetter, C. D. Schleck, W. S. Harmsen, L. K. Iverson, P. J. Santrach, N. K. Henry, and F. R. Cockerill.2003. Comparison of LightCycler PCR, rapid antigen immunoassay, and culture for detection of group A streptococci from throat swabs. J. Clin. Microbiol.41:242–249. 36.Vitali, L. A., C. Zampaloni, M. Prenna, and S. Ripa.2002. PCR M typing: a

new method for rapid typing of group A streptococci. J. Clin. Microbiol. 40:679–681.

37.Wang, D., L. Coscoy, M. Zylberberg, P. C. Avila, H. A. Boushey, D. Ganem, and J. L. DeRisi.2002. Microarray-based detection and genotyping of viral pathogens. Proc. Natl. Acad. Sci. USA99:15687–15692.

38.Whatmore, A. M., V. Kapur, D. J. Sullivan, J. M. Musser, and M. A. Kehoe. 1994. Non-congruent relationships between variation in emm gene se-quences and the population genetic structure of group A streptococci. Mol. Microbiol.14:619–631.

39.Wilson, K. H., W. J. Wilson, J. L. Radosevich, T. Z. DeSantis, V. S. Viswanathan, T. A. Kuczmarski, and G. L. Andersen.2002. High-density microarray of small-subunit ribosomal DNA probes. Appl. Environ. Micro-biol.68:2535–2541.

40.Wilson, W. J., C. L. Strout, T. Z. DeSantis, J. L. Stilwell, A. V. Carrano, and G. L. Andersen.2002. Sequence-specific identification of 18 pathogenic mi-croorganisms using microarray technology. Mol. Cell Probes16:119–127.

on May 15, 2020 by guest

http://jcm.asm.org/

Figure

TABLE 1. Oligonucleotide primers used for real-time PCR and multiplex PCR
TABLE 2. Comparison of resequencing microarray to cultureresults for S. pyogenes-positive clinical samples

References

Related documents

Twenty-five percent of our respondents listed unilateral hearing loss as an indication for BAHA im- plantation, and only 17% routinely offered this treatment to children with

In this work, we use the relationships between some matrix elements of the electromagnetic current of the plus component, “+” for the rho meson [ 20 ], in order to get

Available obstetric or reproductive health information differed for the two groups of women, and when available the following variables were included in adjusted models: for

Active Noise Control is an alternative for passive noise control, by estimating the traditional noise management efforts and their associated problems.Resulting the

Using flexible real coded biogeography-based optimization (FRCBBO), we present the optimization of various objective functions of an optimal power flow (OPF) problem in

In the previous base paper, Dynamic compare and balance algorithm is used that work on two conditions that is overloaded or under loaded according to that further steps are taken.

Analysed multi-storey residential building on the basis of standard design series "KUB 2.5" and its three principal modes of natural oscillations (top down). Quite often,

The Guerrilla Eye Service (GES), a program established by the Department of Ophthalmology of the University of Pittsburgh School of Medicine, is a medical student-run organization