acnes recA gene amplification and sequencing
High throughput 16SrRNA gene sequencing reveals the correlation between Propionibacterium acnes and sarcoidosis
... the sequencing ap- proach can produce data for comprehensive analyses, such as bacterial taxonomy, bacterial diversity, and the correlation of bacterial profile evolution and sarcoidosis ...put sequencing ...
11
Transcriptional analysis of the recA gene of Streptococcus thermophilus
... a recA null mutation before and after 30 min of exposure to 20 ng/ml of mitomicin C by use of RNeasy kit ...the recA gene (A4: GGTGGAAGAAGTCGATCTGATG; A5 CCTTGCTCACCAGAATCAGGC) and for the 16S ribos- ...
8
Detection of rubella virus gene sequences by enzymatic amplification and direct sequencing of amplified DNA
... target cDNA reverse transcribed from RNA extracted from purified stock RV (100 ,ul) (lanes 1 and 2), total cytoplasmic RNA (1 pug) extracted from RV-infected Vero cells at 36 h (lanes 3 [r] ...
8
DETECTION OF RECA GENE IN DEINOCOCCUS RADIODURANS BACTERIA BY USING THE PCR TECHNIQUEN
... to RecA protein so that we are generally detected on RecA gene using molecular assay with Deinococcus Radioduranse specific primer by hemi-nested PCR ...
11
Certified DNA Reference Materials to Compare HER2 Gene Amplification Measurements Using Next-Generation Sequencing Methods
... and sequencing primers from the sequences. The trimmed sequences were mapped to human genome reference hg19 using the Burrows-Wheeler Aligner software version 0.6.2 aln 32 and sample mode in default settings. The ...
9
Analysis of 525 Samples To Determine the Usefulness of PCR Amplification and Sequencing of the 16S rRNA Gene for Diagnosis of Bone and Joint Infections
... rRNA gene PCR in the diagnosis of bone and joint infections has not been systematically ...rRNA gene PCR detection of bacteria in ...rRNA gene PCR yielded identical documentation in 475 ...and ...
11
Whole genome amplification and exome sequencing of archived schistosome miracidia
... exome sequencing are some highly variable genes may be poorly captured and many non-coding regions important for gene regulation are not captured (Biesecker et ...
9
Diversity within Borrelia burgdorferi sensu lato genospecies in Switzerland by recA gene sequence
... In the Light-Cycler PCR technique, detailed analysis of the melting curves shows species-specific peaks. How- ever, due to the short distance separating them, it is of- ten difficult to distinguish one from the other. This ...
9
Assemblages of Giardia duodenalis Isolates from Dogs by Amplification and Restriction of tpi and β Giardin Genes and Sequencing of SSU rDNA Gene
... PCR amplification, restriction analysis, and sequencing of the small subunit ribosomal DNA (SSU-rDNA), β-giardin, and triosephosphate isomerase (tpi) genes in order to establish the similarities or ...
6
In vitro emergence of rifampicin resistance in Propionibacterium acnes and molecular characterization of mutations in the rpoB gene.
... P. acnes. Three substitutions were detected in cluster I of the rpoB gene asso- ciated with either high- or low-level ...rpoB gene of M. tuberculosis and P. acnes revealed that the ...
6
Targeted amplification for enhanced detection of biothreat agents by next generation sequencing
... geted amplification technique could obviously be extended to other applications such as human or animal health, food safety, vaccine or biological product safety, contamination monitoring for manufacturing ...
10
Multiple Displacement Amplification and Whole Genome Sequencing for the Diagnosis of Infectious Diseases
... generation sequencing to allow identification of the ...as gene tags to indicate ...generation sequencing technologies were also used to identify the lineage of the outbreak, 65,67,68 ...varying ...
354
Universal Amplification, Next Generation Sequencing, and Assembly of HIV 1 Genomes
... Next-generation sequencing promises to bridge this gap but is hindered by the lack of methods for the enrichment of vi- rus genomes across the phylogenetic breadth of HIV-1 and methods for the robust assembly of ...
7
Methods for the extraction, storage, amplification and sequencing of DNA from environmental samples
... Yilmaz P, Kottmann R, Field D, Knight R, Cole JR, Amaral- Zettler L, Gilbert JA, Karsch-Mizrachi I, Johnston A, Cochrane G, Vaughan R, Hunter C, Park J, Morrison N, Rocca-Serra P, Sterk P, Arumugam M, Bailey M, ...
51
Propionibacterium acnes: Disease Causing Agent or Common Contaminant? Detection in Diverse Patient Samples by Next Generation Sequencing
... PCR amplification of contaminant templates from samples con- taining nearly no DNA than of the same amount of contaminant templates from complex samples containing human DNA as well competing for the same quantity ...
8
Rapid Divergence of Prolamin Gene Promoters of Maize After Gene Amplification and Dispersal
... g-zein gene in regenerated plants could be due to the absence of Pbf gene expression or change of its epigenetic status of its promoter or ...bisulfite sequencing showed that the 421-bp fragment ...
26
Molecular diagnosis of bacterial endocarditis by broad range PCR amplification and direct sequencing
... PCR amplification of part of the 16S rRNA gene followed by single-strand sequencing was applied to samples of 18 resected heart valves from patients with infective ...patient amplification was ...
7
rpoB Gene Sequencing for Identification of Corynebacterium Species
... digested with EcoRV, DraI, PvuII, StuI, and ScaI. The DNA fragments were then ligated with a GenomeWalker adaptor, which had one blunt end and one end with a 5⬘ overhang. The ligation mixture with the adaptor and the ...
7
Transcription of the Mycobacterium tuberculosis recA gene
... The RecA protein is central to many processes of DNA repair, having a regulatory role in the expression of other DNA repair genes as well as a direct role in recombinational ...tuberculosis recA ...
263
Genome position and gene amplification
... for amplification are thought to be present in amplicons in human cancers, including 8p11-p12 and 17q12 in breast cancer [22-24], ...because gene expression is correlated with copy ...
16