BAFF-R
BAFF promotes proliferation of human mesangial cells through interaction with BAFF-R
... [GenBank:NM_001192.2], BAFF-R [GenBank:NM_ ...follows, BAFF-R: Forward 5′CCCTGGACAAGGTCAT CATT3′, Reverse 5′TCTTGGTGGTCACCAGTTCA3′; BCMA: Forward 5′GCAGTGCTCCCAAAATGAAT3′, Reverse ...
10
Persistence of Viremia and Production of Neutralizing Antibodies Differentially Regulated by Polymorphic APOBEC3 and BAFF-R Loci in Friend Virus-Infected Mice
... and BAFF-R loci, both of which show functional polymorphisms among different strains of ...wild-type BAFF-R resulted in slower production of neutralizing ...or BAFF- R-deficient ...
14
Persistent Friend Virus Replication and Disease in Apobec3-Deficient Mice Expressing Functional B-Cell-Activating Factor Receptor
... The molecular basis for the higher expression of Apobec3 mRNA in B6 mice than in BALB/c, A.BY, and A/WySn mice remains unclear, but a recent study linked this phenomenon to an X-MLV insertion in the Apobec3 exon 2 splice ...
11
BAFF Receptor Deficiency Limits Gammaherpesvirus Infection
... Infection tracked by viral eGFP expression. We then tracked spleen infection by lytic cycle-independent eGFP expression from a viral EF1␣ promoter. Four days after i.p. infection of WT mice (Fig. 5), eGFP was seen mainly ...
11
PD L1(hi) B cells are critical regulators of humoral immunity
... of BAFF, post-RTX treatment, would suggest that human PD-L1 hi B cells are refractory to depletion in a similar way to their murine counterparts via elevated BAFF-R ...of BAFF-R ...
16
BAFF- and APRIL-targeted therapy in systemic autoimmune diseases
... cells. BAFF can be expressed on the cell surface as a membrane-bound form or released as a soluble form after cleavage by ...furin. BAFF binds to three receptors, the BAFF-R, BCMA, or TACI, ...
6
Tumor necrosis factor superfamily member APRIL contributes to fibrotic scar formation after spinal cord injury
... GACATCAGGACTCTGCTCC), BAFF (forward CGAC ACGCCGACTATACGAA; reverse GGTCCGTGTATA GAACCTGGC), BCMA (forward ACTTGCGATGTTC CAACCCT; reverse ATCCGTCAAGCTGACCTGG), TA CI (forward ACGTGTAGCTTCTGCTTCCC; reverse CG ...
8
BAFF/APRIL system in pediatric OMS: relation to severity, neuroinflammation, and immunotherapy
... BAFF-R receptors were measured ex vivo by flow cyto- metry [17]. Peripheral venous blood was delivered to the flow cytometrist within 1 h of collection. A 100 μL ali- quot was blocked with 0.2 mg/mL normal ...
9
B cell activating factor targeted therapy and lupus
... through BAFF-R is necessary for the formation of a mature follicular dendritic cell network in germinal centers and for the survival of late germinal center B cells ...[21-23]. BAFF signals also ...
8
Fichtner, Miriam Franziska Laura (2018): Features of the two isoforms of TACI/TNFRSF13B in soluble and membrane-bound form. Dissertation, LMU München: Medizinische Fakultät
... Zytokine BAFF (B-cell activating factor) und APRIL (A proliferation- inducing ligand) regulieren das Überleben der B-Zellen durch die Bindung an die drei Rezeptoren TACI (transmembrane activator and CAML ...
126
Susceptibility of BAFF-var allele carriers to severe SLE with occurrence of lupus nephritis
... the BAFF-var allele was re- stricted to the lupus nephritis without heightening the frequency of other organ ...the BAFF-var allele might induce the intrarenal overexpression of BAFF besides ...
10
Serum BAFF and APRIL levels in patients with IgG4 related disease and their clinical significance
... through BAFF-R and TACI [22,23,26,27]. Because overexpression of BAFF is known to induce B cell hyperactivation and autoimmunity in mice [28], BAFF has been considered a promoting factor in ...
8
Similarities and differences between selective and nonselective BAFF blockade in murine SLE
... Ad– BAFF-R–Ig–treated mice but were smaller and less fre- quent in Ad–TACI-Ig–treated ...Ad–BAFF- R–Ig, Ad–TACI-Ig (bottom center panel), or left untreated (bottom right panel) similarly shows ...
12
APRIL and BAFF: novel biomarkers for central nervous system lymphoma
... and BAFF-R was confirmed by immunohistochemistry (data not shown), indicating that these cells are fully equipped to respond to APRIL and ...and BAFF showed no effects on proliferation ...whereas ...
14
The current status of targeting BAFF/BLyS for autoimmune diseases
... different BAFF receptors (trans- membrane activator and calcium modulator ligand interactor [TACI; TNFRSF13b], BCMA [B cell maturation antigen; TNFRSF17] and BAFF-R [BAFF receptor; TNFRSF13c]) ...
6
The Correlation Between Non-Hodgkin Lymphoma and Expression Levels of B-Cell Activating Factor and Its Receptors
... and BAFF-R). In addition, BAFF also promotes the generation of immuno- globulin and regulates the immune response ...that BAFF/re- ceptor protein and/or mRNA expression under- went abnormal ...
8
Protein microarray analysis reveals BAFF binding autoantibodies in systemic lupus erythematosus
... Whether BAFF-targeted autoantibodies are a byproduct of a more severe SLE disease state primarily driven by high levels of type I IFNs or serve as a marker of a unique subcohort of individuals with SLE, it is ...
12
Mice overexpressing BAFF develop a commensal flora–dependent, IgA associated nephropathy
... in BAFF- Tg mice is restored upon recolo- nization with commensal ...and BAFF-2 Tg (n = 7) mice after introduction of ASF at 6 weeks of age as measured by ...
13
Increase of Intracellular BAFF in B Cells of Sjögren’s Patients Is Not Affected by Decrease of BAFFR
... of BAFF in SjS patients is linked to enhanced activity of type I interferon system ...higher BAFF mRNA expression identifies SjS patients with higher clinical activity of the disease ...(2). BAFF is ...
7
The role of MerTK and BAFF in dendritic cell-B cell interactions
... of BAFF. BAFF is a type II transmembrane protein that contains a C-terminal cytokine domain which is released upon proteolytic clevage at an extracellular site [126, ...Functionally, BAFF fills a ...
179