Exon 6
The Role of Celf2 in the Signal Induced Alternative Splicing of Lef1 Exon 6 in T Cells
... an exon is preferentially included or excluded from an mRNA ...alternative exon in the pre-mRNA of transcription factor LEF1 and its regulation by the splicing factor ...of exon 6 in LEF1 ...
104
Deletion of ameloblastin exon 6 is associated with amelogenesis imperfecta
... Amelogenesis imperfecta (AI) describes a heterogeneous group of inherited dental enamel defects reflecting failure of normal amelogenesis. Ameloblastin (AMBN) is the second most abundant enamel matrix protein expressed ...
9
Polymorphisms of the ICAM-1 exon 6 (E469K) are associated with differentiation of colorectal cancer
... in exon 6 of the ICAM-1 was significantly different between CRC patients and controls, and between patients with well differentiation and poor differentiation of tumor tis- ...
6
Uroporphyrinogen decarboxylase: a splice site mutation causes the deletion of exon 6 in multiple families with porphyria cutanea tarda
... causes exon 6 to be deleted from the mRNA. The intron/exon junctions on either side of exon 6 fall between codons, so the resulting protein is shorter than the normal protein, missing ...
8
Antisense oligonucleotide–mediated MDM4 exon 6 skipping impairs tumor growth
... Mdm4 is unproductively spliced in most normal adult tissues and in differentiated ESCs. To test whether AS contributes to the regula- tion of MDM4 protein abundance in physiological conditions, we measured the extent of ...
18
A novel chimeric CYP11B2/CYP11B1 combined with a new p.L340P CYP11B1 mutation in a patient with 11OHD: case report
... to 6 on one allele, and unfortunately, a pathogenic mis- sense mutation appeared on exon 6 of CYP11B1 in the other allele, which resulted in a seemingly homozygous missense mutation that was ...
5
PDGFRA exon 12 (5 cases, 5%), PDGFRA exon 14 (1 cases, 1.0%), PDGFRA exon 11 (1 cases, 1.0%),
... gccccattgattctttcatc EXON 1 FORWARD cggaaaatctgaccggcg EXON 1 REVERSE aactgccactggagagcatt EXON 1 REVERSE tgagctcttggttgggctc EXON 2 FORWARD gggtgaatctagtggggctt EXON 2 FORWARD ...
6
Improvement of marker-based predictability of Apparent Amylose Content in japonica rice through GBSSI allele mining
... in exon 4 at position +715 from the ATG causing an Asp to Gly aminoacid ...in exon 6 at position ...second exon, 100 bp downstream the ATG, causing a premature stop codon which inactivates the ...
18
Getz_unc_0153M_17796.pdf
... A105V within Exon 4 and G>C = A182P, G>A = R199H, and G>A = G205S within Exon 6. G>A = R199H was associated with a somatic mutation found in Verruciform xanthoma tissues and the others ...
56
Thesis
... Figure 3. Casz1 mRNA is expressed in the looped heart at stage E10.5. (A,B) Whole mount E10.5 mouse embryo using an Nkx2.5 probe. (C,D) Whole mount E10.5 mouse embryo using a Casz1 exon 6-7 probe. (FBA) ...
19
Decreased performance in IDUA knockout mouse mimic limitations of joint function and locomotion in patients with Hurler syndrome
... in exon 6 [13, 14], and they were shown to have similar phenotypes with those of MPS I-H ...into exon 9, and they found correlations with other MPS I-H animal model charac- teristics, including ...
9
Whole genome sequencing in an acrodermatitis enteropathica family from the Middle East.
... Mutation Nucleotide c.1191insC c.850G>A c.184T>C c.143T>G c.192+19G>A c.283C>T c.318C>A c.475-2A>G c.251C>T c.511G>T c.599C>T Exon Exon 6 Exon 5 Exon 1 Exon 1 Intron 1 Exon 2 Exon 2 Intr[r] ...
9
8q24 amplified segments involve novel fusion genes between NSMCE2 and long noncoding RNAs in acute myelogenous leukemia
... PVT1 exon 1a and NSMCE2 exon 3 in the patient (Figure 1d and e), and a fusion gene between exon 6 of NSMCE2 and exon 1 of BF104016, a noncoding RNA sharing the sequence of CCDC26 ...
5
Modulation of in vitro splicing of the upstream intron by modifying an intra exon sequence which is deleted from the dystrophin gene in dystrophin Kobe
... that exon 19 of the dystrophin gene bearing 52-bp deletion was skipped during splicing, although the known consensus sequences at the 5' and 3' splice sites of exon 19 were maintained (Matsuo, ...of ...
7
A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER)
... The nucleotide sequence, amino acid sequence and domain structure of the human IL-7 receptor α chain (NM_002185) was used in the basic local alignment search tool (BLAST) and simple modular architecture research tool ...
11
MMSplice: modular modeling improves the predictions of genetic variant effects on splicing
... On the Vex-seq data, MMSplice showed a large improvement over HAL and SPANR. First, MMSplice could score all 1098 variants of the test set whereas HAL could only score 572 (52.1%) and SPANR 966 (88%) of them. Second, the ...
15
A Feminist Response to the Exon Bill
... Exon's biggest departure from Miller is that its categories of obscenity, filth, lewdness and indecency have no defining community reference point. The bill does not indicate[r] ...
38
Identification of New Viral Genes and Transcript Isoforms during Epstein-Barr Virus Reactivation using RNA-Seq
... Considering the enriched localization of EBNA-3A, EBNA-3B, EBNA-3C, EBNA-2, EBNA-LP, and LMP2 transcripts in the nu- cleus (Fig. 6), we need to consider the possibility that some of these transcripts may perform ...
10
Exon expression profiling reveals stimulus mediated exon use in neural cells
... following three modifications: 100 ng starting RNA (rather than 1 μg) was used; the rRNA reduction step was not carried out; and in the second cycle of cDNA synthesis, a second cDNA strand was synthesized before the ...
16
Murine Hepatitis Virus nsp14 Exoribonuclease Activity Is Required for Resistance to Innate Immunity
... the ExoN activity of the Lassa fever virus nucleoprotein degrades dsRNA intermediates (18, 19), we hypothesized that CoV nsp14 ExoN could function in a similar ...nsp14 ExoN activity also has been ...
15