Human peripheral T cells
Replication of human cytomegalovirus in human peripheral blood T cells.
... This prompted us to investigate the comparative replication of HCMV in different human leukocyte subpopulations with special regard to T lymphocytes stimulated in the allogeneic mixed ly[r] ...
8
Preferential activation and expansion of human peripheral blood gamma delta T cells in response to Toxoplasma gondii in vitro and their cytokine production and cytotoxic activity against T gondii infected cells
... delta T cells. Cytofluorometric analysis of T cells obtained from either umbilical cord blood or peripheral blood from adults revealed that V gamma 9+ and V delta 2+ gamma delta ...
11
Generation of HIV Latency in Humanized BLT Mice
... mononuclear cells, the viral RNA detected was being produced by all the productively infected cells in each tissue and not latently infected cells ...in peripheral blood and thymo- ...on ...
5
The Effect of CCCP on Mitophagy in CD4 CD25 Regulatory T Cells in Human Peripheral Blood
... in cells by directly inducing single-stranded, and double-stranded DNA breaks, or by oxidising fatty acids, amino acids in proteins, or enzymatic cofactors, and can directly attack ...
18
Ex Vivo Stimulation and Expansion of both CD4+ and CD8+ T Cells from Peripheral Blood Mononuclear Cells of Human Cytomegalovirus-Seropositive Blood Donors by Using a Soluble Recombinant Chimeric Protein, IE1-pp65
... transfected U373MG astrocytoma cells (8) using a reverse transcriptase-PCR Superscript kit (Gibco). Primers corresponding to the 5⬘ and 3⬘ ends of IE1 cDNA were GATCCGGATCCATGGAGTCCTCTGCCAAGAGA, with a BamHI ...
8
Peripheral Blood Cytotoxic γδ T Lymphocytes from Patients with Human Immunodeficiency Virus Type 1 Infection and AIDS Lyse Uninfected CD4+ T Cells, and Their Cytocidal Potential Correlates with Viral Load
... of peripheral blood ␥␦ T cells has been reported during HIV-1 infection (8, 53), the immunological consequences of this phenomenon have not yet been ...␥␦ T cells induced in the early ...
8
Cytokines in chronic inflammatory arthritis II Granulocyte macrophage colony stimulating factor in rheumatoid synovial effusions
... of human peripheral blood macrophage-depleted non-T cells treated with synovial fluids, supernatants of synovial tissue explants, and recombinant granulocyte- macrophage (rGM)-CSF were ...of ...
8
Staphylococcal exotoxin superantigens induce human immunodeficiency virus type 1 expression in naturally infected CD4+ T cells.
... Using naturally infected peripheral blood mononuclear cells depleted of CD8+ T cells, we have shown that staphylococcal exotoxins are powerful inducers of human immunodeficiency virus ty[r] ...
5
Effect of human bone marrow mesenchymal stromal cells on cytokine production by peripheral blood naive, memory, and effector T cells
... + T-cell populations, were transferred to a ...CD8+ T cells: IL-10: QT00041685; IL-2: QT00015435; IL-4: QT00012565; TGF-β: QT00000728; CTLA4: QT 01670550) (Qiagen) in a final volume of 10 ...
14
Selective expansion of human gamma delta T cells by monocytes infected with live Mycobacterium tuberculosis
... delta T cells in draining lymph nodes and ...delta T cell lines with reactivity to mycobacterial antigens have been derived from synovial fluid of a rheumatoid arthritis patient, skin lesions of ...
6
Alpha Interferon and HIV Infection Cause Activation of Human T Cells in NSG-BLT Mice
... of human fetal liver and thymus tissue (Thy/Liv) plus intravenous injection of autologous liver-derived hematopoietic stem pro- genitor cells ...of human leukocytes in the mouse peripheral ...
10
Original Article EDAG-1 promotes the proliferation of human T-acute lymphoblastic leukemia cells by activating MAPK/Erk and Akt signaling pathways
... man T-cell acute lymphoblastic leukemia (T-ALL) cells and peripheral blood of patients with T-ALL, but its functional significance in T-ALL was ...in T-ALL. Our results ...
9
Peripheral antibody concentrations are associated with highly differentiated T cells and inflammatory processes in the human bone marrow
... aged T cells contribute to the defects in B cell function ...B cells are known to decrease in the BM with age [43], and the expression of the adhesion molecules CD49d and CD50, which are important ...
10
Detection of human T cell lymphotropic virus type I proviral DNA and its gene expression in synovial cells in chronic inflammatory arthropathy
... the peripheral blood mononuclear cells (PBMCs) and synovial fluid cells (SFCs), but also in the T lymphocyte-depleted cultured synovial cells ...synovial cells can be transcribed ...
9
Allergen specific CD8+ T cells and atopic disease
... allergen-specific T cells have diminished IL-10 production capacity in severely affected atopics compared with asymptomatic ...+ T cell epitopes. Using human leukocyte antigen-A*0201–peptide ...
10
Peripheral T-lymphocyte activation by human T-cell leukemia virus type I interferes with the CD2 but not with the CD3/TCR pathway.
... Indeed, HTLV-I particles were shown to be mitogenic for resting T cells obtained from human peripheral blood either CD4 or CD8 or for thymocytes 12.. This initial activation should, in t[r] ...
7
An investigation of the effects of the antioxidants, ebselen or N-acetyl cysteine on human peripheral blood mononuclear cells and T cells
... status of the cell is hindered on oxidation of even a small amount of GSH. This oxidation results in the for- mation of GSSG and mixed disulfides between protein sulfhydryl groups in biological systems. It will also de- ...
16
Resistance to Replication of Human Immunodeficiency Virus Challenge in SCID-Hu Mice Engrafted with Peripheral Blood Mononuclear Cells of Nonprogressors Is Mediated by CD8+T Cells and Associated with a Proliferative Response to p24 Antigen
... levels of virus in plasma are a heterogeneous group, a small subgroup of patients with truly nonprogressive human immu- nodeficiency virus (HIV) infection likely hold important clues to the basis of an effective ...
6
Distribution and Evolution of T-Cell Receptor Vβ Repertoire on Peripheral Blood Lymphocytes of Newborn Infants of Human Immunodeficiency Virus (HIV)-Infected Mothers: Differential Display on CD4 and CD8 T Cells and Effect of HIV Infection
... ⫹ human T cells have been performed with mixed populations of adult individuals of various ages, and the observed repertoire may reflect the antigenic experience of each ...(naı¨ve) T ...
8
Cytokine profile and induction of T helper type 17 and regulatory T cells by human peripheral mononuclear cells after microbial exposure
... PBMC was detectable from early culture (6h, data not shown) and maintained up to 72 hours, while cord blood PBMC and CRL 9580 cells showed a later appearance of cytokines in culture (48-72 hours, Fig. 2a,b), the ...
35