Maximum parsimony
On the computational complexity of the maximum parsimony reconciliation problem in the duplication-loss-coalescence model
... a maximum parsimony formulation in which each type of event in the model has an associated non-negative cost and the objec- tive is to find a reconciliation of minimum total ...first maximum ...
12
Maximum Parsimony on Phylogenetic networks
... the parsimony criterion on a network has been defined as the sum total of the substitution costs on the edges of a tree (a sub- graph of the network) that minimizes the parsimony score of the ...The ...
10
A mixed integer linear programming model to reconstruct phylogenies from single nucleotide polymorphism haplotypes under the maximum parsimony criterion
... Interestingly, sometimes in real applications the num- ber of haplotypes can be much bigger than the number of SNPs. Hence, it is important to test the ability of an exact algorithm to tackle instances of the MPPEP-SNP ...
14
Accuracy and Power of Statistical Methods for Detecting Adaptive Evolution in Protein Coding Sequences and for Identifying Positively Selected Sites
... The maximum parsimony approach to detecting positive selection in protein coding nucleotide sequences was de- scribed in Suzuki and Gojobori (1999; see also Fitch et ...the parsimony method (Fitch ...
12
Genetic and Phenotypic Changes Accompanying the Emergence of Epizootic Subtype IC Venezuelan Equine Encephalitis Viruses from an Enzootic Subtype ID Progenitor
... by maximum-parsimony phylogenetic methods revealed 25 nucleotide differences which were predicted to have accompanied the 1992 epizootic emergence; 7 of these encoded amino acid changes in the nsP1, nsP3, ...
6
Phylogenetic Evaluation of Series Delimitations in Section Palmata (Acer, Aceroideae, Sapindaceae) Based on Sequences of Nuclear and Chloroplast Genes
... Both maximum parsimony and maximum likelihood analyses of DNA sequence data of nuclear rDNA ITS and chloroplast genes (ndhF, trnL–trnF, and psbA–trnH) from 23 species of Acer section Palmata show ...
8
Factors affecting the performance of phylogenetic methods : a thesis presented in partial fulfilment of the requirements for the degree of Ph D in Mathematics at Massey University
... "the maximum parsimony tree" , as in my sim ulations I have used a branch and bound method to effectively search all possible ..."maximum parsimony" trees: with statistical j ...
288
Comparative Analysis of Avian Influenza Virus Diversity in Poultry and Humans during a Highly Pathogenic Avian Influenza A (H7N7) Virus Outbreak
... Detection of sources of human A (H7N7) virus infection. To discriminate mutations that emerged in poultry from mutations that were detected in viruses from humans only, the data set was supplemented with 232 veterinary A ...
7
Molecular Characterization of Iranian Encarsia formosa Gahan Populations with Natural Incidence of Wolbachia Infection
... The fragments with length of 438, 422 and 404 bp were selected for the phylogenetic analysis based on D2-28S rRNA, COI and wsp sequences respectively. Phylogenetic relationships were determined based on maximum ...
16
Tracing Melioidosis Back to the Source: Using Whole Genome Sequencing To Investigate an Outbreak Originating from a Contaminated Domestic Water Supply
... using maximum parsimony showed only minimal differences (one to four SNPs across the entire genome) among all outbreak isolates, including the two clinical isolates from patients 741 and ...1 Maximum ...
5
Two novel species of Aspergillus section Nigri from indoor air
... Maximum Parsimony analysis (MP) was performed for all data sets using the heuristic search option and Close- Neighbor-Interchange algorithm (with search level 1 in which the initial trees were obtained with ...
15
Bioinformatics Analysis the Complete Sequences of Cytochrome b of Takydromus sylvaticus and Modeling the Tertiary Structure of Encoded Protein
... Cytochrome b (cyt b) gene complete sequences (1143bp) of Takydromus sylvaticus were se- quenced. In order to clarify the phylogenetic position of the Takydromus sylvaticus, we inves- tigated the phylogeny of 15 ...
7
Articles
... Bootstrap support values are given above branches receiv- ing > 50% bootstrap support A The 100% strict consensus tree of 667 most maximum parsimony trees based on the analysis of [r] ...
12
Analysis of Gene Sequences and Hereditary Construction for Five Loach Population Cytochrome B
... the maximum parsimony method were consistent in showing that five groups of 31 kinds of haploid formation of three main branches, among farmed green loach there are 11 unique haplotypes (Hap21-Hap31) ...
6
Diversity of Actinobacteria in Gilakaladindi Mangrove Ecosystem of Andhra Pradesh, India
... VJPR-7 to Streptomycetes nogalater, VJPR-8 to Streptomycetes enissocaesilis and VJPR-24 to Streptomycetes xiamensis. The partial 16S rRNA sequences of all the strains were submitted to the Genbank database under ...
7
Cladistic Parsimony, Historical Linguistics and Cultural Phylogenetics
... cladistic parsimony works in biology and consider briefly one such parsimony analysis on ...cladistic parsimony for a number of reasons: (1) the method is relatively simple and non-technical, and ...
47
Extensive population genetic structure in the giraffe
... using maximum parsi- mony (equally weighted) (MP), maximum likelihood (ML), and minimum evolution (ME) ...analyses. Maximum parsimony and ME analyses were executed in PAUP* ...effect. ...
13
Phlogeny and Biogeography of the Prayer Plant Family
... trnL-F IGStrnFf ATTTGAACTGGTGACACGAG see Taberlet et a!. Prince) Taberlet et a!.. Statistics for maximum parsimony analyses of relationships in Marantaceae using data fro[r] ...
16
A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping and DNA sequence data. III. Cladogram estimation.
... Starting at the ends of the DNA region being ex- amined, keep adding additional sites and constructing maximum parsimony cladograms until there is evi- dence for [r] ...
15
Bounding probabilities in a Markovian model of character evolution
... For the model considered here where we assume an even distribution of colours at the root, we have the following result: Theorem 10 Maximum parsimony and maximum likelihood with no commo[r] ...
32