Phage c2 depends on lactococcal proteins for replication
The role of transcription in lactococcal phage replication : a thesis presented in partial fulfilment of the requirements for the degree of Doctor of Philosophy in Microbiology at Massey University, Palmerston North, New Zealand
... plasmid replication is dependent on the length and sequence of the PE1 ...that phage-encoded proteins are not essential for c2 origin ...of lactococcal proteins to the PE 1 ...
201
Monoclonal Antibodies Raised against Native Major Capsid Proteins of Lactococcal c2-like Bacteriophages
... the c2 species, was purified by CsCl gradient and used to immunize BALB/c ...the c2 species and not with phages of the 936 and P335 species, with a Lactococcus lactis cell extract, or with phage ...
5
Structure, Adsorption to Host, and Infection Mechanism of Virulent Lactococcal Phage p2
... g Lactococcal siphophages from the 936 and P335 groups infect the Gram-positive bacterium Lactococcus lactis using receptor binding proteins (RBPs) attached to their baseplate, a large multiprotein complex ...
11
Structure and Functional Analysis of the Host Recognition Device of Lactococcal Phage Tuc2009
... Promega. Phage template DNA was obtained by infecting ...tripod proteins (BppUA Tuc2009 , BppUL Tuc2009 , BppAL Tuc2009 , and BppUAL Tuc2009 ), PCR products encompassing the genes for each combi- nation ...
12
Intracellular directed evolution of proteins from combinatorial libraries based on conditional phage replication
... GCAACCATTATCTTCGCCGAAGATAAAATAGTCAACTTCGGCGAAGATAGATATTTATCACCGCCGGTGATAGATTTAACGT CGTTGGTAATAGAAGCGGCTTCTATTTTATCAGTTGAAGCCGCTTCTATCTATAAATAGTGGCGGCCACTATCTAAATTGCA 5T6T 5T6T CS Supplementary Figure 1. Sequences of ...
49
Classification and Replication Mechanism of Staphylococcus Phage
... of phage in lysogeny ...encoding proteins for the lytic pathway including replication, head/tail morphogenesis, packaging and lysis functions is followed by a leftward-transcribed ...
6
Visualizing a Complete Siphoviridae Member by Single-Particle Electron Microscopy: the Structure of Lactococcal Phage TP901-1
... receptor-binding proteins anchored to the host adsorption apparatus ...whole phage TP901-1 (P335 species) and propose a composite EM model of this gigantic molecular ...structural proteins among ...
8
Resistance Evolution against Phage Combinations Depends on the Timing and Order of Exposure
... LPS-binding phage following a type IV pilus-binding phage decreased the relative fitness of the host, whereas there was no significant change in the cost between the two stages of sequential exposure in the ...
15
DNA binding proteins of the phage λ ninR region
... The in vitro studies with NinH revealed that it behaved very much like the bacterial Fis protein as predicted by bioinformatics analysis. NinH displayed a preference for dsDNA over ssDNA along with a greater affinity for ...
91
Characterization of the oriI andoriII Origins of Replication in Phage-Plasmid P4
... of replication has been observed from the crr site, it is likely that the ␣ proteins bound to the type I iterons present in crr do not form a nucleoprotein complex competent for ...
9
Pf Filamentous Phage Requires UvrD for Replication in Pseudomonas aeruginosa
... that replication of Pf filamentous phage of P. aeruginosa depends on the DNA repair UvrD ...stalled replication forks after replication has been interrupted ...chromosome ...
14
Hepatitis C Virus Replication Depends on Endosomal Cholesterol Homeostasis
... viral replication or- ganelle are only partially ...transfer proteins implicated in direct lipid transfer at various endoplasmic reticulum (ER)-membrane contact ...RNA replication but not for ...
26
Are Phage Lytic Proteins the Secret Weapon To Kill Staphylococcus aureus?
... of phage lytic proteins active against ...these proteins offers many possibilities for their manipulation, and data about protein-substrate interaction will be very valuable in understanding their ...
17
Interactions of Claspin with replication and checkpoint proteins
... 32 ABSTRACT ATR (ATM and Rad3-related) initiates a DNA damage signaling pathway in human cells upon DNA damage induced by UV and UV-mimetic agents and in response to inhibition of DNA replication. Genetic data ...
127
Shotgun phage display — Selection for bacterial receptins or other exported proteins
... filamentous phage assembles in the bacterial membrane. This rare way of replication enables construction of libraries from which proteins with signal peptides can be ...the phage coat protein ...
13
Therapeutic Proteins through Phage Display- A Brilliant Technique for its Simplicity
... M13 phage coat proteins namely pIII, pVI, pVII, PVIII and pIX are attempted for the display of antibodies and ...pIII proteins as shown in Figure ...adopting phage display for the expression ...
6
Inhibition of Herpes Simplex Virus Type 1 Replication by Adeno-Associated Virus Rep Proteins Depends on Their Combined DNA-Binding and ATPase/Helicase Activities
... DNA replication is specific for HSV-1 and not due to general cytotoxicity of Rep, we assessed whether the amounts of Rep78 plasmid used were compatible with AAV DNA rep- ...DNA replication. To this end, we ...
17
Replication efficiency of bovine papillomavirus type 1 DNA depends on cis-acting sequences distinct from the replication origin.
... of replication of bovine papillomavirus type 1 DNA include the origin region and two trans-acting factors, the E1 and E2 ...the replication efficiency of a DNA molecule which contains these three elements ...
6
Overcoming the Phage Replication Threshold: a Mathematical Model with Implications for Phage Therapy
... of phage as antimicrobial therapeutic ...lytic phage therapy treatment of bacterial infections in vivo in which they argue that administration of therapeutic phage must be carefully timed to coincide ...
8
Site directed biotinylation of filamentous phage structural proteins
... The ability to efficiently biotinylate phages with preci- sion should open new avenues for the biotechnological application of phages. In vivo biotinylation of phage Pro- tein 3 has already been reported. Scholle ...
8