Yeast mating and interaction
Prm1 Prevents Contact-Dependent Lysis of Yeast Mating Pairs
... a mating pair indicates that the function of Prm1 extends beyond merely protecting the cell in which it is ...an interaction be- tween preexisting channels in each membrane, analogous to the assembly of a ...
10
Mutations in the YRB1 Gene Encoding Yeast Ran-Binding-Protein-1 That Impair Nucleocytoplasmic Transport and Suppress Yeast Mating Defects
... ual spores from tetratype asci was examined at various temper- carrying the yrb1-51 or yrb1-52 mutation, and the re- atures. Left, genetic interaction of yrb1-51 with nup2::HIS3 is sulting diploids were ...
17
The coordination of cell growth during fission yeast mating requires Ras1 GTP hydrolysis
... The spatial and temporal control of polarity is fundamental to the survival of all organisms. Cells define their polarity using highly conserved mechanisms that frequently rely upon the action of small GTPases, such as ...
20
Development of an optimized interaction mating protocol for large scale yeast two hybrid analyses
... Screening a cDNA library with the yeast two-hybrid system is laborious and time consuming. For large-scale and multi- parallel screenings, current protocols are limited, and approaches using arrays and automated ...
7
The Phage Mating Theory, With Lessons for Yeast Geneticists
... If mating involved discrete, pairwise interaction between phage chromo- somes, the frequency of e 1 and of rII 1 recombinants should be depressed to the same extent—for both genes, mating with the ...
6
Expression-State Boundaries in the Mating-Type Region of Fission Yeast
... epigenetic states in fission yeast during mitosis and meiosis. Cell Partridge, J. F., B. Borgstrøm and R. C. Allshire, 2000 Distinct 86: 95–101. protein interaction domains and protein spreading in a ...
12
Protein Kinases Involved in Mating and Osmotic Stress in the Yeast Kluyveromyces lactis
... the interaction detected between components of the MAPK module and scaffold proteins, two-hybrid studies indicate that some of the protein kinases associate with each other independently of their association with ...
8
Molecular Mechanism of Flocculation Self Recognition in Yeast and Its Role in Mating and Survival
... this interaction is established in two stages, involving both glycan-glycan and protein-glycan ...of interaction was demonstrated: Ca 2ⴙ takes part in the binding of the carbohydrate to the protein, and the ...
16
Mapping of a Yeast G Protein βγ Signaling Interaction
... The mating pathway of Saccharomyces cerevisiae is widely used as a model system for G protein-coupled receptor-mediated signal ...of mating pheromones, G protein bg subunits transmit the signal to a MAP ...
11
Evidence for Interaction of Schizophyllum commune Y Mating-Type Proteins in Vivo
... using a Quickchange mu- tagenesis kit (Stratagene). Complementary pairs of primers were used as fol- lows: 5⬘ CGAGATCTTGTGCGAACTAGTTTACTGACA 3⬘ and its complement bind in the TEF1 promoter 36 bp 5⬘ of the Y4 start ATG, ...
8
Membrane Organization and Cell Fusion During Mating in Fission Yeast Requires Multipass Membrane Protein Prm1
... ABSTRACT The involvement of Schizosaccharomyces pombe prm1 + in cell fusion during mating and its relationship with other genes required for this process have been addressed. S. pombe prm1D mutant exhibits an ...
25
The Gα Subunit Signals through the Ste50 Protein during the Mating Pheromone Response in the Yeast Kluyveromyces lactis
... activating mating have been described in other yeast species; however, nothing is known about their possible ...regulates mating positively (37, ...in mating through a MAPK cas- cade (11), but ...
7
Interaction Between Genetic Background and the Mating-Type Locus in Cryptococcus neoformans Virulence Potential
... DISCUSSION The model yeast Saccharomyces cerevisiae and the hu- man pathogenic fungus C. albicans have relatively small MAT loci consisting of just a few genes, which facilitates the generation of isogenic strains ...
9
An Evolutionary Perspective on Yeast Mating-Type Switching
... in yeast species is controlled by a reversible, programmed DNA-rearrangement process called mating- type ...budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces ...
24
The Yeast Mating-Type Switching Mechanism: A Memoir
... of yeast and of sporulation of yeast and ...the yeast mating-type switching ...industrial yeast strains was ...the mating-type allele (MATa/MATa or MATa/MATa) containing the D ...
7
A Filamentous Growth Response Mediated by the Yeast Mating Pathway
... budding yeast Saccharomyces cerevisiae respond to mating pheromones by arresting their cell-division cycle in G1 and differentiating into a cell type capable of locating and fusing with mating ...
10
Evolution of Mating Systems in Basidiomycetes and the Genetic Architecture Underlying Mating-Type Determination in the Yeast Leucosporidium scottii
... In this study, we provide a detailed molecular character- ization of the mating system of L. scottii. Using newly gener- ated genome sequence data of two compatible strains, we determined the chromosomal regions ...
27
RAS/Cyclic AMP and Transcription Factor Msn2 Regulate Mating and Mating-Type Switching in the Yeast Kluyveromyces lactis
... Autoregulation of MTS1 transcription. Others recently pub- lished a chromatin immunoprecipitation analyzed genome- wide by hybridization to a microarray (designated ChIP-on- chip) using epitope-tagged Mts1 (9). By ...
8
Mating in wild yeast: delayed interest in sex after spore germination
... ARTICLE Mating in wild yeast: delayed interest in sex after spore germination ABSTRACT Studies of laboratory strains of Saccharomyces cerevisiae have uncovered signal- ing pathways involved in ...
9
MATING-TYPE FUNCTIONS FOR MEIOSIS AND SPORULATION IN YEAST ACT THROUGH CYTOPLASM
... Since the expression of both mating-type alleles is essential for sporulation (ROMAN and SANDS 1953), these functions were provided by constructing heterokaryotic zygotes betwee[r] ...
9