[PDF] Top 20 Development and Assessment of a Multiplex Real Time PCR Assay for Quantification of Human Immunodeficiency Virus Type 1 DNA
Has 10000 "Development and Assessment of a Multiplex Real Time PCR Assay for Quantification of Human Immunodeficiency Virus Type 1 DNA" found on our website. Below are the top 20 most common "Development and Assessment of a Multiplex Real Time PCR Assay for Quantification of Human Immunodeficiency Virus Type 1 DNA".
Development and Assessment of a Multiplex Real Time PCR Assay for Quantification of Human Immunodeficiency Virus Type 1 DNA
... several PCR-based methodologies had been developed for the quantification of cell-associated HIV-1 DNA, based on end-point and real-time PCR methodology ...of ... See full document
6
One Step, Multiplex, Real Time PCR Assay with Molecular Beacon Probes for Simultaneous Detection, Differentiation, and Quantification of Human T Cell Leukemia Virus Types 1, 2, and 3
... lymphotropic virus types 1 (HTLV-1), 2 (HTLV-2), and 3 (HTLV-3) belong to a group of primate retroviruses with certain common epidemiological and biolog- ical properties, including tropism for T ... See full document
7
Detection of Human Immunodeficiency Virus Type 1 DNA in Dried Blood Spots by a Duplex Real Time PCR Assay
... HIV-1 DNA copies in a constant human blood ...and DNA extraction. Fifty l of EDTA venous blood specimens from human subjects and from the DBS standard panel were spotted onto the pre- ... See full document
7
Multiplex, Quantitative, Real Time PCR Assay for Cytomegalovirus and Human DNA
... CMV DNA in blood and the likelihood of disease (2, 5, 7, 10–13, 17, 20, ...of DNA is an additional advantage that is important because specimens may have to be transported before testing (18, ...The ... See full document
6
An enhanced sensitivity branched DNA assay for quantification of human immunodeficiency virus type 1 RNA in plasma
... bDNA assay to test panels of HIV-1 culture isolates diluted into HIV-1-seronegative serum provided by the ACTG Viral Quality Assurance Program (proficiency panel 03) (Ta- ble 2, panel A) and a panel ... See full document
7
Simultaneous Detection of Multiplex Amplified Human Immunodeficiency Virus Type 1 RNA, Hepatitis C Virus RNA, and Hepatitis B Virus DNA Using a Flow Cytometer Microsphere Based Hybridization Assay
... The development of nucleic acid amplification technologies has found many applications in biomedical research and in diagnostic ...low-copy-number DNA or RNA allows one to make an early and rapid diagnosis ... See full document
6
Simple Subtyping Assay for Human Immunodeficiency Virus Type 1 Subtypes B, C, CRF01 AE, CRF07 BC, and CRF08 BC
... the assay by sequence-based phylogenetic anal- ...nested multiplex PCR were accurate, all HIV- positive samples were analyzed by sequencing and phylogenetic ...By PCR with one set of inner ... See full document
7
Performance of a Novel Human Immunodeficiency Virus (HIV) Type 1 Total Nucleic Acid Based Real Time PCR Assay Using Whole Blood and Dried Blood Spots for Diagnosis of HIV in Infants
... HIV-1 DNA test v1.5. The samples were processed first using the Amplicor HIV-1 DNA test ...LC DNA isolation kit I according to the high- performance ...HIV-1 DNA test ... See full document
5
Simultaneous Quantification of Epstein Barr Virus, Cytomegalovirus, and Human Herpesvirus 6 DNA in Samples from Transplant Recipients by Multiplex Real Time PCR Assay
... the multiplex real-time PCR assay in the quantification of EBV, CMV, and HHV-6 ...the multiplex assay was as sensitive and specific as the single ... See full document
7
Real Time PCR Assay of Individual Human Immunodeficiency Virus Type 1 Variants in Coinfected Human Lymphoid Tissues
... in human immunodeficiency virus (HIV) infec- tion, since the extremely high mutation rate results in rapid swarm development and the dominance of certain quasispecies is strongly associated ... See full document
6
Real Time PCR Assay for Clinical Management of Human Immunodeficiency Virus Infected Patients with Visceral Leishmaniasis
... a real-time PCR for Leishmania DNA in the diagnosis and follow-up of patients with human immunodeficiency virus type 1 (HIV-1) and Leishmania ... See full document
6
Quantification of Human Immunodeficiency Virus Type 1 Proviral Load by a TaqMan Real Time PCR Assay
... HIV-1 DNA after normalization of the ...HIV-1 DNA per cell, as expected. Therefore, in each subsequent TaqMan assay an 8E5 control was introduced, with the limit for an acceptable ... See full document
8
Quantification of Proviral Load of Human Immunodeficiency Virus Type 2 Subtypes A and B Using Real Time PCR
... HIV-2 DNA and RNA assay standards. DNA templates were derived from a PCR-amplified region of the gag gene of HIV-2 strain ...ROD DNA in fresh PBMC was amplified by nested PCR ... See full document
5
Multicenter Performance Evaluation of a New TaqMan PCR Assay for Monitoring Human Immunodeficiency Virus RNA Load
... TaqMan real-time PCR assay, the COBAS TaqMan human immunodeficiency virus (HIV) (HPS-CTM HIV) PCR assay, recently developed for the quantification of ... See full document
5
Development and Validation of a Multiplex Real Time PCR Assay for Simultaneous Genotyping and Human T Lymphotropic Virus Type 1, 2, and 3 Proviral Load Determination
... The human T-lymphotropic virus (HTLV) proviral load remains the best surrogate marker for disease ...progression. Real-time PCR techniques have been developed for detection and ... See full document
10
A Genotype Independent Real Time PCR Assay for Quantification of Hepatitis B Virus DNA
... in-house real-time PCR assay against a WHO standard and plasmids of HBV genotypes A through ...H. DNA extracted from 200- l serum samples from patients who were previously deter- ... See full document
6
Comparison of a Multiplex Real Time PCR Assay with a Multiplex Luminex Assay for Influenza Virus Detection
... H1N1 virus pandemic, the detection of influenza virus types A and B and differentiation between influ- enza virus A subtypes became important for monitoring the out- ...influenza virus A ... See full document
6
Real Time PCR for Diagnosis of Human Bocavirus Infections and Phylogenetic Analysis
... a virus of worldwide distribution (3, 6, 8, 10, 18, 19, ...conventional PCR methods with agarose gel electro- ...a real-time PCR ...this assay proved to be sensitive, spe- cific, ... See full document
7
Development of a new ultra sensitive real time PCR assay (ultra sensitive RTQ PCR) for the quantification of HBV DNA
... (sense) 5 ’ -GCCAAAATTCGCAGTCCC-3 ’ , 0.5 μ M pri- mer hbv460 (antisense) 5’-GATAGTCCAGAAGAAC- CAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the 5’ ... See full document
6
Development and application of SYBR Green I real time PCR assay for the separate detection of subgroup J Avian leukosis virus and multiplex detection of avian leukosis virus subgroups A and B
... of virus distribution and load of ALV-J in different organs in each group at 30 weeks post-infection by p27 antigen de- tection, routine PCR and real-time PCR ...5, virus copies ... See full document
10
Related subjects