[PDF] Top 20 Functional mapping and DNA sequence of an equine herpesvirus 1 origin of replication.
Has 10000 "Functional mapping and DNA sequence of an equine herpesvirus 1 origin of replication." found on our website. Below are the top 20 most common "Functional mapping and DNA sequence of an equine herpesvirus 1 origin of replication.".
Functional mapping and DNA sequence of an equine herpesvirus 1 origin of replication.
... Furthermore, comparison of known origin sequences demonstrated that a 9-bp sequence, CGTTCGCAC, which is conserved among all origins of replication of human lytic herpesviruses and which[r] ... See full document
9
Sequence Requirements for Interaction of Human Herpesvirus 7 Origin Binding Protein with the Origin of Lytic Replication
... little sequence similarity with the HHV-6 oriLyts; it is one of the most diver- gent regions between the genomes of these viruses (data not ...Fig. 1, within the 817-bp HHV-6B oriLyt region is a 400-bp ... See full document
12
Cloning, sequencing, and functional analysis of a Marek's disease virus origin of DNA replication.
... A comparison of MDV replicon sequences with other herpesvirus replication origin sequences revealed a 90-bp sequence containing 72% identity to the lytic origin oris of herpes simplex vi[r] ... See full document
5
Identification and analysis of a lytic-phase origin of DNA replication in human herpesvirus 7.
... available sequence information, from the flanking regions of the HHV-7 genome (H7O3, TTGTTACTGTAAAGTATCGAATTC, and H7O4, TCTCTTGCGATTATTGAGGAAGCTT); these primers contain an EcoRI and a HindIII restriction site, ... See full document
6
Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Contains Two Functional Lytic Origins of DNA Replication
... which DNA sequences were removed from the 5⬘ and 3⬘ ends of subclone pDA12 (Table 1 and ...the replication efficiency was decreased to approximately 70% of that of the full-length ori- Lyt, ... See full document
7
Human herpesvirus 6B origin-binding protein: DNA-binding domain and consensus binding sequence.
... a DNA-binding assay that the human herpesvirus 6B (HHV-6B) replication origin has a structure similar to those of alphaherpesviruses, although the HHV-6B and herpes simplex virus type 1 ... See full document
9
Herpesvirus of Turkeys (Meleagridis Herpesvirus 1) Encodes a Functional MicroRNA 221 Homolog with High Sequence Conservation
... virus replication, in vitro growth kinetics of the pHVT3 virus was compared with that of the mutant viruses in a time course plaque ...similar replication kinetics (Figure 2(a)) demonstrating that ... See full document
9
Mapping the Sequences That Mediate Interaction of the Equine Herpesvirus 1 Immediate-Early Protein and Human TFIIB
... its DNA-binding do- main within aa 422 to 597, which recognizes the consensus sequence motif (ATCGT) ...the DNA-binding domain, was defective in activating expression of the pTK-CAT ...the ... See full document
12
Genome Sequence of Bovine Herpesvirus 4, a Bovine Rhadinovirus, and Identification of an Origin of DNA Replication
... Notes on further genes. Until now, RNAs of six genes of BoHV-4 were demonstrated experimentally to be spliced. Be- sides Bo5, Bo10, and Bo11, these are ORFs 29, 50, and 57 (7, 44). ORF 29 encodes terminase, a protein ... See full document
9
Mapping and characterization of the origin of DNA replication of porcine circovirus.
... of DNA replication of PCV in its host ...particle. DNA from the defective interfering particle is single stranded, covalently closed, and of positive sense and represents a defined region of the ... See full document
5
A Review: Interactions of Equine Herpesvirus 1 with Immune System and Equine Lymphocyte
... to 1 year after infection ...encoding equine IgD ...the equine immunoglobulins; equine IGHD and IGHG7 ...monitoring equine IgGa, IgGb, IgG (T) IgA and IgM in nasal wash samples from ... See full document
15
Potential of Equine Herpesvirus 1 as a Vector for Immunization
... (flank 1), wtgag or syngag sequences, and poly(A) sequences (flank 2) ...(Fig. 1). Flanks 1 and 2 were obtained by performing a standard PCR using primers 1a (5⬘-GGAATTCTCCCACTCGTA TCGTCGGTC-3 ⬘ ) ... See full document
10
Equine herpesvirus type 1 infection induces procoagulant activity in equine monocytes
... alphaherpesvirus, equine herpesvirus type 1 (EHV-1), is a highly prevalent cause of equine infectious abortion and ...within 1 to 4 h, with maximal activity at 24 h, after ... See full document
14
Identification and nucleotide sequence of the glycoprotein gB gene of equine herpesvirus 4.
... The EHV-4 gB protein contains features characteristic of all envelope glycoproteins, namely, a 5' hydrophobic signal sequence, an external hydrophilic surface domain, a hydrophobic membr[r] ... See full document
11
The Gene 10 (UL49.5) Product of Equine Herpesvirus 1 Is Necessary and Sufficient for Functional Processing of Glycoprotein M
... incomplete trimming of sugar moieties of gM in infected and stably or transiently transfected cells. These findings and the absence of gM processing and transport to the TGN in cells infected with the UL49.5-negative ... See full document
12
Identification and characterization of the ICP22 protein of equine herpesvirus 1.
... proteins are expressed from the IR4 293-aa ORF, iii show that during a lytic infection theIR4 protein is localized to the nucleus and exhibits a diffuse staining pattern, iv demonstrate [r] ... See full document
12
Equine Herpesvirus Type 1 Enhances Viral Replication in CD172a+ Monocytic Cells upon Adhesion to Endothelial Cells
... (iii) Immortalization of endothelial cells. Endothelial cell lines were immortalized by transduction of the genes encoding the simian virus 40 large T-antigen (SV40LT) and human telomerase reverse transcriptase (hTERT). ... See full document
12
Genetic relatedness of equine herpesvirus types 1 and 3.
... Thus, the addition of the unlabeled second viral DNA EHV-3 to the hybridization reaction increased the concentration of sequences homologous to only a restricted portion of the probe DNA[r] ... See full document
7
Immunological Correlates of Vaccination and Infection for Equine Herpesvirus 1
... EHV-specific IgG isotyping, first performed on nasal washes in a study reported by Breathnach et al. (5), has been adapted to assess the isotypes and relative abundances of EHV-1-specific antibodies in horse sera ... See full document
7
Redox Potential Regulates Binding of Universal Minicircle Sequence Binding Protein at the Kinetoplast DNA Replication Origin
... Kinetoplast DNA, the mitochondrial DNA of the trypanosomatid Crithidia fasciculata, is a remarkable structure containing 5,000 topologically linked DNA ...Their replication is initiated at two ... See full document
12
Related subjects