[PDF] Top 20 Vpr Is Required for Efficient Nef Expression from Unintegrated Human Immunodeficiency Virus Type 1 DNA
Has 10000 "Vpr Is Required for Efficient Nef Expression from Unintegrated Human Immunodeficiency Virus Type 1 DNA" found on our website. Below are the top 20 most common "Vpr Is Required for Efficient Nef Expression from Unintegrated Human Immunodeficiency Virus Type 1 DNA".
Vpr Is Required for Efficient Nef Expression from Unintegrated Human Immunodeficiency Virus Type 1 DNA
... expressed from HIV IN ⴚ , and the levels are not affected by ...the expression of all viral transcripts was demonstrated from integrase-defective viruses in infected cells, including tat/rev ... See full document
9
Human Immunodeficiency Virus Type 1 Vpr Induces the Degradation of the UNG and SMUG Uracil-DNA Glycosylases
... which Vpr was used as bait to screen a human cDNA library identified the cellular uracil DNA glycosylase (UDG) UNG as a binding partner (3, ...that Vpr might serve to bring UNG into ...in ... See full document
10
Enzymatically Active APOBEC3G Is Required for Efficient Inhibition of Human Immunodeficiency Virus Type 1
... Cell culture, transfections, and construction of HeLa-APO3G cell lines. HeLa cells were propagated in Dulbecco’s modified Eagle’s medium (DMEM) con- taining 10% fetal bovine serum. HeLa cell lines stably expressing wt ... See full document
8
A conserved LXXLF sequence is the major determinant in p6gag required for the incorporation of human immunodeficiency virus type 1 Vpr.
... of Vpr with viral particles ...n 1 3, and n 1 4 of the L-X-S-L-F-G motif, respectively, totally abolished the ability of the chimeric particles to incorporate Vpr ...n 1 2 and n ... See full document
6
Human immunodeficiency virus type 1 Vpu and cellular TASK proteins suppress transcription of unintegrated HIV 1 DNA
... the virus, TASK proteins can be viewed as HIV-1 host restric- tion ...transcription from uDNA may be essential to efficient replication as this function is present in Vpu and therefore ... See full document
12
Human Immunodeficiency Virus Type 1 Vpr Protein Does Not Modulate Surface Expression of the CD4 Receptor
... of Vpr to modulate surface CD4, we first performed experiments in which both Vpr (HIV-1 ...in human embry- onic kidney 293T cells. In this setting, Vpr and CD4 were expressed ... See full document
6
Association of Nef with the Human Immunodeficiency Virus Type 1 Core
... which Nef may enhance HIV-1 infec- tivity is by altering the intracellular transport of the incoming viral ribonucleoprotein ...Because Nef interacts with components of the endocytic machinery to ... See full document
7
Human immunodeficiency virus type 1 Vpr protein binds to the uracil DNA glycosylase DNA repair enzyme.
... HIV-1 Nef protein (5) was used as an irrelevant protein in the binding ...uracil DNA gly- cosylase inhibitor (UGI; New England Biolabs) was incubated for 10 min with ... See full document
8
Human Immunodeficiency Virus Type 1 Inhibits DNA Damage-Triggered Apoptosis by a Nef-Independent Mechanism
... light. Nef ex- pression did not significantly affect the patterns of caspase activation in infected Jurkat cells ...because virus infection inhibited cell ...with nef ⫹ or nef-defective ... See full document
10
Human Immunodeficiency Virus Type 1 Vpr Modulates Cellular Expression of UNG2 via a Negative Transcriptional Effect
... detected from the WB analysis of HeLa-CD4 infected cells using anti- Vpr antibody to detect both HA-Vpr and native Vpr in trans- fected and infected cells, respectively (data not ...FIG. ... See full document
8
Human immunodeficiency virus type 1 Vpr interacts with HHR23A, a cellular protein implicated in nucleotide excision DNA repair.
... Mammalian expression constructs. The dual expression plasmids BSVprThy and BSVprXThy (23) contain either Vpr or the C-terminal truncation mutant VprX and the Thy ...expressed from tandem ... See full document
11
Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription
... strong-stop DNA. These results were consistent for four to six independent virus stocks and suggest that the ability of tat to efficiently initiate HIV-1 reverse transcription is largely dependent on ... See full document
10
Separation of Human Immunodeficiency Virus Type 1 Replication from nef-Mediated Pathogenesis in the Human Thymus
... HXB/LW nef gene was then repaired by a recombination PCR (RPCR) site-directed mutagenesis method described previously ...the vpr gene, and primer HIV3⬘-X (CGGCTCTAGAGATTTTCCACACTGACTA AAAGG), which anneals ... See full document
9
The Interaction of Vpr with Uracil DNA Glycosylase Modulates the Human Immunodeficiency Virus Type 1 In Vivo Mutation Rate
... through Vpr incor- poration. Since virion incorporation of Vpr is required to in- fluence the in vivo mutation rate, we have explored whether UNG could be recruited into virus ...in ... See full document
9
Integration is essential for efficient gene expression of human immunodeficiency virus type 1.
... Together with an observation that the mutant lacked the ability to integrate, these results indicated that the integration was required for efficient viral gene expression and productive[r] ... See full document
6
Sustained Induction of NF-κB Is Required for Efficient Expression of Latent Human Immunodeficiency Virus Type 1
... gene expression. The transient nature of RNA Pol II recruitment to HIV-1 LTR DNA after TNF- ␣ pulse-stimula- tion suggested that these stimulation conditions might not in- duce exit of HIV-1 ... See full document
14
Nuclear Export of Human Immunodeficiency Virus Type 1 Vpr Is Not Required for Virion Packaging
... that Vpr accumu- lated in cytoplasmic membrane-containing fractions with an efficiency that closely matched that seen for the wild-type virus ...of Vpr in the cytoplasm of ... See full document
5
DDB1 and Cul4A Are Required for Human Immunodeficiency Virus Type 1 Vpr-Induced G2 Arrest
... gene expression assays specific for ...induce Vpr expression before the addition of either DMSO or .../G 1 ratios were calculated by dividing the proportion ... See full document
9
Evidence for Gene Expression by Unintegrated Human Immunodeficiency Virus Type 1 DNA Species
... transcription from a DNA molecule comprising an LTR-LTR ...HIV-1 DNA molecules that have not been integrated or cir- cularized upon infection are degraded rapidly ...assumed from our ... See full document
9
Nef stimulates human immunodeficiency virus type 1 proviral DNA synthesis.
... The Nef protein of human immunodeficiency virus type 1 (HIV-1) stimulates viral ...disrupted nef genes were 4 to 40 times less infectious than wild-type ... See full document
9
Related subjects