[PDF] Top 20 Transrepression of lck gene expression by human T-cell leukemia virus type 1-encoded p40tax.
Has 10000 "Transrepression of lck gene expression by human T-cell leukemia virus type 1-encoded p40tax." found on our website. Below are the top 20 most common "Transrepression of lck gene expression by human T-cell leukemia virus type 1-encoded p40tax.".
Transrepression of lck gene expression by human T-cell leukemia virus type 1-encoded p40tax.
... murine leukemia virus ...of lck gene ...the lck DP D E-Box-CAT construct ...the human lck DP is involved in the transrepression of lck gene ... See full document
9
Highly Enhanced Expression of CD70 on Human T-Lymphotropic Virus Type 1-Carrying T-Cell Lines and Adult T-Cell Leukemia Cells
... Viral gene and antigen expression in HTLV-1-carrying T- cell ...comprehensive gene expression in HTLV-1-carry- ing T-cell lines was examined by ... See full document
10
Transcriptional activation of the vascular cell adhesion molecule-1 gene in T lymphocytes expressing human T-cell leukemia virus type 1 Tax protein.
... of T cells through the blood-brain barrier are favored by adhesion molecule- mediated interactions of circulating T cells with endothelial ...in human T-cell leukemia ... See full document
9
Altered Expression of Tyrosine Kinases of the Src and Syk Families in Human T-Cell Leukemia Virus Type 1-Infected T-Cell Lines
... All cell lines were maintained in RPMI with Glutamax supplemented with 10% fetal calf serum, penicillin, and streptomycin (Life Technologies, ...a cell line derived from peripheral blood from a patient with ... See full document
9
Interleukin 1 gene expression in adult T cell leukemia
... adult T cell leukemia (ATL) is a T cell neoplasm etiologically associated with human T lymphotropic virus type I (HTLV-I) ...interleukin 1 ... See full document
7
Stromal Cell-Mediated Suppression of Human T-Cell Leukemia Virus Type 1 Expression In Vitro and In Vivo by Type I Interferon
... Human T-cell leukemia virus type 1 (HTLV-1) causes adult T-cell leukemia (ATL), HTLV-1-associated myelopathy/tropical spastic ... See full document
8
Costimulation of cytokine gene expression in T cells by the human T leukemia/lymphotropic virus type 1 trans activator Tax.
... CD28 cell surface receptor has been shown by mutational analysis to require the CK-1 element within the TxRRs of both genes (9, 10, ...of T-cell receptor signals for func- tion ...reporter ... See full document
8
The tax gene of human T-cell leukemia virus type 2 is essential for transformation of human T lymphocytes.
... Human T-cell leukemia virus type 1 (HTLV-1) and type 2 (HTLV-2) are oncogenic retroviruses associated with human T-cell malignancies and ... See full document
9
Silencing of human T cell leukemia virus type I gene transcription by epigenetic mechanisms
... Human T-cell leukemia virus type I (HTLV-I) is associated with a neoplastic disease, adult T-cell leukemia (ATL), and inflammatory diseases, such as ... See full document
16
Human T-Cell Leukemia Virus Type 1 Tax Protein Down-Regulates Pre-T-Cell Receptor Alpha Gene Transcription in Human Immature Thymocytes
... The human pre-T-cell receptor alpha (TCR ␣ ; pT ␣ ) gene encodes a polypeptide which associates with the TCR  chain and CD3 molecules to form the pre-TCR ...surface expression of the ... See full document
8
SFA-1, a novel cellular gene induced by human T-cell leukemia virus type 1, is a member of the transmembrane 4 superfamily.
... A recombinant plasmid pL2neoSR a IIISFA-1 was constructed by inserting the 2.5-kb SalI fragment of pcDSR a SFA-1 into the SalI site of the pL2neoSR a III vector (55). NIH 3T3 cells were transfected with 10 ... See full document
6
Chimeric Matrix Proteins Encoded by Defective Proviruses with Large Internal Deletions in Human T-Cell Leukemia Virus Type 1-Infected Humans
... that expression of defective proviruses with large internal deletions could take place in vivo, we isolated total RNA from fresh PBMC of 6 ATLL and 14 asymptomatic carriers for RT-PCR or RT-PCR plus Southern ... See full document
8
Regulation of expression driven by human immunodeficiency virus type 1 and human T-cell leukemia virus type I long terminal repeats in pluripotential human embryonic cells.
... 1398 Downloaded from http://jvi.asm.org/ on November 10, 2019 by guest Human pluripotential embryonic teratocarcinoma cells differentially expressed gene activity controlled by the human[r] ... See full document
10
Evidence for Cooperative Transforming Activity of the Human Pituitary Tumor Transforming Gene and Human T-Cell Leukemia Virus Type 1 Tax
... Stable expression of neo, PTTG, Tax, and PTTG plus Tax in G418-selected NIH 3T3 ...(lane 1), NIH 3T3 Tax-neo (lane 2), NIH 3T3 PTTG-neo (lane 3), and NIH 3T3 PTTG plus Tax-neo (lane 4) were prepared, ... See full document
8
Phosphorylation regulates human T cell leukemia virus type 1 Rex function
... Rex-1 expression vector SE356, which contains the HTLV-1 tax/rex cDNA expressed from the cytomegalovirus (CMV) immediate-early gene promoter, was described previously ...Rex-1 ... See full document
11
Cellular Gene Expression upon Human Immunodeficiency Virus Type 1 Infection of CD4+-T-Cell Lines
... immunodeficiency virus type 1 (HIV-1) is an envel- oped retrovirus that causes severe depletion of the immune system in humans, leaving them susceptible to infection with other ...optimize ... See full document
11
Role of O-Glycosylation and Expression of CD43 and CD45 on the Surfaces of Effector T Cells in Human T Cell Leukemia Virus Type 1 Cell-to-Cell Infection
... reporter gene with the neomycin resistance gene from the pcDNA ...of gene expression, we ex- ploited the pGIPZ mir30-based lentiviral vector from Open ...CD45 expression. To reduce CD43 ... See full document
12
Transcriptional Control of Spliced and Unspliced Human T-Cell Leukemia Virus Type 1 bZIP Factor (HBZ) Gene
... boldface type): AGGATGGG (positions 34 to 41)3AGTCGGGG for the GATA-binding protein 2 (GATA-2) site, GCTGTCGCT (positions 41 to 49)3 GCGCTACCT for the Tax and CREB (TaxCREB) sites, GCTGGCTC (posi- tions 47 to ... See full document
10
Mouse Model for the Equilibration Interaction between the Host Immune System and Human T-Cell Leukemia Virus Type 1 Gene Expression
... of human T-cell leukemia virus type 1 (HTLV-1) in the growth of and gene suppression in Tax-expressing tumor cells in vivo, we established a model system ... See full document
11
Human T-Cell Leukemia Virus Type 1 Tax Relieves Repression of Proliferating Cell Nuclear Antigen Gene Expression
... ⫺ 1, 5 ⬘ -TCGAGCGCGCTTGCGGACGCGGCGGCTAGACGCGC TTGCGGACGCGGCGGCATTAAACGGTTA-3⬘; 2X ⌬ PIR, 5⬘-TCGAGAC ATCTTGCGGACGCGGCGGCTAGAACATCTTGCGGACGCGGCGGCA TTAAACGGTTA-3⬘; and 2X ⌬ PDR, 5⬘-TCGAGCGCGCTTGCGATCTGG G C G G C ... See full document
9
Related subjects