• No results found

[PDF] Top 20 A Yeast under Cover: the Capsule of Cryptococcus neoformans

Has 10000 "A Yeast under Cover: the Capsule of Cryptococcus neoformans" found on our website. Below are the top 20 most common "A Yeast under Cover: the Capsule of Cryptococcus neoformans".

A Yeast under Cover: the Capsule of Cryptococcus neoformans

A Yeast under Cover: the Capsule of Cryptococcus neoformans

... C. neoformans PKA1 gene product has a clear role in capsule production (33), sinces a pka1 strain is acapsular and ...case, capsule production is not restored by exogenous cAMP, sug- gesting that PKA ... See full document

9

Parallel β-Helix Proteins Required for Accurate Capsule Polysaccharide Synthesis and Virulence in the Yeast Cryptococcus neoformans

Parallel β-Helix Proteins Required for Accurate Capsule Polysaccharide Synthesis and Virulence in the Yeast Cryptococcus neoformans

... the capsule- defective mutants that have previously been tested for viru- lence in that pbx1 ⌬ and pbx2 ⌬ cells build a sizable capsule, most of which is correctly ...C. neoformans polysaccharide ... See full document

11

Activity of tannins from Stryphnodendron adstringens on Cryptococcus neoformans: effects on growth, capsule size and pigmentation

Activity of tannins from Stryphnodendron adstringens on Cryptococcus neoformans: effects on growth, capsule size and pigmentation

... Cryptococcus neoformans is an encapsulate opportunistic yeast that can cause cryptococcosis, predominantly in immunocompromised patients with underlying predis- posing factors, such as organ ... See full document

10

Temporal Behavior of Capsule Enlargement by Cryptococcus neoformans

Temporal Behavior of Capsule Enlargement by Cryptococcus neoformans

... of capsule growth is challenging due to the capsule’s high water content (⬃99% [vol/vol]) (21), which con- tributes to a small refractive index difference in aqueous solutions that precludes observation by simple ... See full document

6

Analysis of the Protein Kinase A Regulated Proteome of Cryptococcus neoformans Identifies a Role for the Ubiquitin Proteasome Pathway in Capsule Formation

Analysis of the Protein Kinase A Regulated Proteome of Cryptococcus neoformans Identifies a Role for the Ubiquitin Proteasome Pathway in Capsule Formation

... shared under the repressed and induced con- ...identified under Pka1-repressed and Pka1-induced conditions highlighted the influence of modulation of Pka1 ... See full document

15

Methamphetamine Enhances Cryptococcus neoformans Pulmonary Infection and Dissemination to the Brain

Methamphetamine Enhances Cryptococcus neoformans Pulmonary Infection and Dissemination to the Brain

... polysaccharide capsule is im- portant for adhesion of the yeast and biofilm development in ...C. neoformans coloniza- tion and biofilm ...C. neoformans did correlate with the number of ... See full document

10

Virulence of Cryptococcus neoformans  Regulation of capsule synthesis by carbon dioxide

Virulence of Cryptococcus neoformans Regulation of capsule synthesis by carbon dioxide

... Cryptococcus neoformans is variably encapsulated in vitro, whereas in tissues it develops a large ...[DME]). Capsule size was quantitated physically by measuring cell volume, and chemically by ... See full document

10

Pbx Proteins in Cryptococcus neoformans Cell Wall Remodeling and Capsule Assembly

Pbx Proteins in Cryptococcus neoformans Cell Wall Remodeling and Capsule Assembly

... reduced capsule poly- saccharide synthesis of the pbx ...this capsule moiety than on mannose, for example, which is a major component of both structures, leading to the altered ratio of these components ... See full document

12

Lipophilic Dye Staining of Cryptococcus neoformans Extracellular Vesicles and Capsule

Lipophilic Dye Staining of Cryptococcus neoformans Extracellular Vesicles and Capsule

... Cryptococcus neoformans is an encapsulated yeast that causes systemic mycosis in immunosuppressed ...the capsule which are consistent with vesicular ...the capsule of C. ... See full document

8

Capsule Growth in Cryptococcus neoformans Is Coordinated with Cell Cycle Progression

Capsule Growth in Cryptococcus neoformans Is Coordinated with Cell Cycle Progression

... different yeast species, such as Candida albicans, Saccharomyces cerevisiae, and Ustilago maydis (39, 54, ...since capsule enlargement can be considered in C. neoformans as a morpholog- ical ... See full document

13

Capsule Structural Heterogeneity and Antigenic Variation in Cryptococcus neoformans

Capsule Structural Heterogeneity and Antigenic Variation in Cryptococcus neoformans

... C. neoformans, we examined the expression of PS epitopes in serotype D and serotype C strains during different growth phases as revealed by MAb ...the yeast cells transitioned into sta- tionary growth, ... See full document

10

Experimental modulation of capsule size in Cryptococcus neoformans

Experimental modulation of capsule size in Cryptococcus neoformans

... C. neoformans is a pathogenic yeast that is acquired from the environment during mammalian ...the capsule is uniformly ...the capsule is usually small ...in capsule size ...influence ... See full document

6

The Buoyancy of Cryptococcus neoformans Is Affected by Capsule Size

The Buoyancy of Cryptococcus neoformans Is Affected by Capsule Size

... of Cryptococcus to different levels of osmotic stress is consistent with our observations showing that high salt concentra- tions do not alter cell ...C. neoformans and ...the yeast in the ... See full document

13

Ordered Kinetochore Assembly in the Human Pathogenic Basidiomycetous Yeast Cryptococcus neoformans

Ordered Kinetochore Assembly in the Human Pathogenic Basidiomycetous Yeast Cryptococcus neoformans

... Fluorescence microscopy. Cells were grown in the YPD medium for 14 to 16 h and pelleted at 4,000 rpm. The cells were then washed once with distilled water and finally resuspended in distilled water. The cells were placed ... See full document

8

Mixed Infections and In Vivo Evolution in the Human Fungal Pathogen Cryptococcus neoformans

Mixed Infections and In Vivo Evolution in the Human Fungal Pathogen Cryptococcus neoformans

... IMPORTANCE Cryptococcus neoformans is a life-threatening human fungal pathogen that is present in the environment and is responsible for an estimated 1 million cases of cryptococcosis/year, predominantly ... See full document

9

Characterization of Clinical and Environmental Isolates of Cryptococcus neoformans/Cryptococcus gattii Complex Maintained in Yeast Culture Collection in São Paulo, Brazil

Characterization of Clinical and Environmental Isolates of Cryptococcus neoformans/Cryptococcus gattii Complex Maintained in Yeast Culture Collection in São Paulo, Brazil

... the capsule in the isolated from AIDS ...in yeast virulence in animal models, observing a decrease in the activity of this enzyme when the gene is altered [45] ...C. neoformans com- plex [45] [46] ... See full document

17

Radial Mass Density, Charge, and Epitope Distribution in the Cryptococcus neoformans Capsule

Radial Mass Density, Charge, and Epitope Distribution in the Cryptococcus neoformans Capsule

... the capsule and providing a structural framework for the addition of new fibers in the higher-density ...after capsule enlarge- ment support the current model of capsule growth, in which the newer ... See full document

15

Role of an Expanded Inositol Transporter Repertoire in Cryptococcus neoformans Sexual Reproduction and Virulence

Role of an Expanded Inositol Transporter Repertoire in Cryptococcus neoformans Sexual Reproduction and Virulence

... expressed under dif- ferent culture ...growth under high-inositol conditions and during mating on MS medium containing ...induced under both culture conditions, especially ITR1A, which represented ... See full document

14

Invasion of the Central Nervous System by Cryptococcus neoformans Requires a Secreted Fungal Metalloprotease

Invasion of the Central Nervous System by Cryptococcus neoformans Requires a Secreted Fungal Metalloprotease

... episomal yeast expression vector under the constitutive GDP pro- moter with the following primers: forward, GTAGAATTCATGCGCTCC TCCGCGCTCATC; and reverse, TACAAGCTTTCAAGATTTGGTCGG ...CnMPR1. Yeast ... See full document

13

Cryptococcosis Serotypes Impact Outcome and Provide Evidence of Cryptococcus neoformans Speciation

Cryptococcosis Serotypes Impact Outcome and Provide Evidence of Cryptococcus neoformans Speciation

... We used clinical data and isolates collected during the nationwide surveillance on cryptococcosis and the CryptoA/D study to fur- ther analyze Cryptococcus biology and the disease it causes. Parts of the data sets ... See full document

12

Show all 10000 documents...