Polyomavirus late leader region serves an essential spacer function necessary for viability and late gene expression.

Polyomavirus Late Leader Region Serves

an

Essential Spacer

Function Necessary for

Viability and Late Gene Expression

GUY R. ADAMIAND GORDON G. CARMICHAEL*

DepartmentofMicrobiology, University of Connecticut Health Center, Farmington, Connecticut06032 Received 23 September1985/Accepted 20 January 1986

Allthreepolyomaviruslate mRNAs contain multiple tandem copies of thesamenontranslated57-nucleotide sequence,the lateleader,attheir5'ends. We show here thatapolyomavariant (ALM) lacking 48central bases ofthe 57-base leader unit is nonviable by plaque assayand by a newmethod fortesting virus viability, an immunofluorescence burstassay.ALM is, however, unaffected in early geneexpressionasmeasured both by indirect immunofluorescence of large T antigen and by transformation levels ofratF- 11lcells. DNA replication inmousecellsisalsoaswild type,andthe defect in ALM iscomplemented byanearly-defectivehelper virus DNA. ALM does not make detectable levels of late viralproteinsand isminimally 200-fold depressed in the accumulation ofcytoplasmic polyadenylatedlate RNA. When thedeleted leadersequenceof ALM isreplaced byavariety ofprocaryoticsequences, viabilityalmostalwaysreturns.Some of the substituted leader variants produceplaques with thesameapparentkineticsaswild-type viral DNA. The indication is that the sequence ofthepolyoma late leader is not important for lategeneexpression but that it hasanessentialspacerfunction on the RNA orDNA level. This spacer function is apparently necessary for late viral RNA transcription, processing, orstability.

The 5'-nontranslated sequences of polyomavirus late mRNAs are unusually heterogeneous. At least 15 different capped termini map throughout a 125-nucleotide region, from nucleotide5075 tonucleotide5168 on the viral genome

(5, 12, 17, 42). In addition, late messages contain variable

numbersofa reiterated 57-nucleotide late leader sequence

(nucleotides 5020 to 5076) at their 5' ends (24, 41). The

polyomavirus genome is circular, and owing to inefficient transcriptional termination, RNA polymerase II can make

multiple circuits while transcribinginthe lateorientation(1,

2). The result is giant

primary

transcripts consisting of

tandemgenomicrepeats.

Thelate leader sequence (present in a single copy in the DNA) is part of the 400 base pairs (bp) making up the nontranslated regulatory region of the polyomavirus ge-nome.Figure1Adiagrams this region ofthe DNA. This area

ofthe genome has been much studied as it contains the

replication origin, the early transcriptional enhancer, and promoters for both earlyand latetranscription (5, 7, 8, 18,

27, 32, 43, 44).Bordering both ends ofthe lateleader unitare

excellent splice donor and acceptor sites. The model for processing ofmultiple-genomic-length transcripts is

repre-sented in Fig. 1B for a two-genome-length transcript. By intramolecular splicing all but the 57-base late leader se-quence is spliced out as a genome-length intron. The net result is that cytoplasmic mRNAs coding for late viral

proteinshave multiple5' leaders. The late leader unit itself has not beenexaminedin muchdetail.Within the late leader sequence there is a 10-nucleotide sequence that shows

strong complementarity tothe 3' end ofmouse 18S rRNA (38). Nuclease protection studies have revealed 40S ribo-somalsubunit-bindingsitesspecificallywithin the late leader sequence (23). These findings support a model in which multiple late leaders promote ribosome binding and thus moreefficient translation of late messages.

Beyond thepreliminary investigation mentioned above it

*Corresponding author.

is not known why the virus uses such aseeminglyinefficient

method to generate multiple late leaders. In an effort to

determine leader function we created a group ofmutants with most of the late leader deleted and replaced with

unrelatedsequencesof somewhat similar length. Ourresults

withthese mutantsdemonstrated the necessityofthe leader sequencefor virus

viability,

butapparently onlyas aspacer sequence. Bases 5026 to 5073(48 ofthe 57basesofthelate

leader) are expendable but must be replaced by another

sequenceforthe virus to be viable.

MATERIALS ANDMETHODS

Materials.Enzymeswerefrom NewEnglandBioLabs,Inc. (Beverly, Mass.). a-32P-labeled deoxynucleoside triphos-phates (800Ci/mmol)werefromNewEngland Nuclear Corp.

(Boston, Mass.) or AmershamCorp. (Arlington Heights, Ill.). Fluorescein-conjugated goat antirat and rabbit antigoat antibodies were from Cooper Biomedical, Inc. (West

Chester,

Pa.).

Synthetic oligonucleotides,

used as

primers

for

sequence verification ofmutants, were synthesized with a

Systec model 1450A synthesizer. Hybond-mAP-paper for

RNAisolationwas fromAmersham.

Cells and culturetechniques. Cells weregrown on plastic

dishes with DulbeccomodifiedEagle medium

containing

5%

(NIH 3T3) or 10% (F-111) calfserum and antibiotics. Pas-sagewascarried outwithatrypsin

(0.025%,

wt/vol)-EDTA

(0.2%, wt/vol)

solution prepared in phosphate-buffered

sa-line(PBS). NIH3T3 mouse cells and

F-ill

ratcellswere as

describedpreviously(13).

F-li

cells wereused for

transfor-mation studies as described previously (13), and NIH 3T3 cellswereusedforplaqueassays(13),propagationofmutant viruses, and immunofluorescence studies.

Mutant construction. The starting vectorfor mutant con-struction was plasmid pPy, which is the entire genome of

polyomavirusstrain59RA(11,37)insertedattheBamHI site into pBR322. This plasmid was propagated in Escherichia

coli GM48 (F+ lac gal ara thrglu phi

T1,

T6r dam3 dcm6

sup'),

obtained from Henryk Cudny, or in HB101. The

417

on November 10, 2019 by guest

http://jvi.asm.org/

A

_{POLYOMA ORIGIN /PROMOTER REGION}

replication ori

m

100 1/5295

late stort sites

[image:2.612.130.484.267.372.2]

AAA{

loteRNA

... vv-vvv-vvlaeu_ leaderunit

5i00

enhoncer region 5100

rT W 1w l

it

Bc

HinfIBclI 5000

B

PROCESSING

OF

TWO

GENOME-LENGTH

PRIMARY

TRANSCRIPT

leader-to-leader splice leader-to-bodysplice

5 LL VPI body LL VPI AAAAAA

Mature VP I Message ₅ LL LL_* VPI body _{' AAAAAA}

FIG. 1. (A) Region of thepolyomavirusgenomewhich contains the early and late mRNAstartsites, the enhancer for early transcription, theorigin ofreplication, and the late leader unit. The stippledarearepresentstheregion of the leaderexonwhich has been deleted in the nonviable mutantALM.ori, Origin. (B) Model for processing of late primary transcripts and production of multiple, tandem nontranslated leaders. Polyomavirus late mRNAs contain variable numbers of tandem, 57-nucleotide nontranslated "leader" unitsattheir5'ends. These

aregenerated by splicing from giant primary transcripts resulting from inefficient transcription termination. The example shown is for a

primary transcript created bytwocircuits of RNA polymeraseIIaround theviralgenome.Thefinal mRNA containstwotandem leaderunits (LL) attachedtoa"body"segmentencoding the major structural protein, VP1. For all latemessages,the firstinitiator AUG codon is within

themessagebodysegment.

abbreviated leader mutant, ALM, was formed by deleting most of the sequences from the unique Bcll site at

polyomavirus nucleotide 5021 (numbering system asin

ref-erence 38) to the Hinfl site at nucleotide 5076 in pPy. Plasmid pPy DNA was linearized with BclI, and the ends were made blunt with DNA polymerase I, Klenowenzyme

(28). These molecules were then treated with calf intestine alkalinephosphatase followed by digestionwithBglI. Sepa-rately, theHinfl fragment spanning nucleotides 5073to 385

was isolated from pPy, the ends were made flush with the

Klenowenzyme, and then thefragment was cutwith BglI. Although several BglI sites arepresentinthevector, itwas

possibletotakeadvantageof the fact thatBglItendstoleave unique sticky ends. WhentheBglI-digested Hinfl fragment

wasgel isolated and then ligatedtotheBclI-BglI-cutvector, theresultwas acomplete pPylackingaBclI-Hinfl fragment. This construct (ALM) carriesa48-bp deletionin the leader exonbutretainsauniqueBcll site and 3bp junctionaltothe leader-leader spliceacceptor siteatthe 5' end of the leader

exonand6bp adjacenttothesplice donor siteatthe3'end of the leader. As for all mutants constructed, the entire sequencefrom theBclI siteatnucleotide5021totheBglIsite at nucleotide90 wasverified by subcloning into phage M13 vectorsfollowed by dideoxy DNA sequencing.

SLM M, SLM MR, and SLM B were constructed as follows. Plasmid pBR322 was digested withBglI andRsaI.

The 365-bpfragment spanning nucleotides 3482to 3847was gel isolated and partially digested with Sau3AI. The result-ant fragments were ligated into BclI-cut, phosphatase-treated ALM DNA. SLM M contains an insert ofpBR322

sequences 3689 to 3736 in the leader region. SLM MR contains the same sequences, but in opposite orientation. SLM B contains thesameinsertasSLMM,but also has 18 additional basesas aresult ofonly partial Sau3AI cleavage of thepBR322 BglI-RsaI fragment.

To construct SLM C, phage M13mp8 replicative form DNAwas digested withBglII and ClaI, and the endswere made flush with the Klenow enzyme and then ligated to BclI-cut, filled-in ALM molecules. Unexpectedly, the final clone from this procedure also contained an insert of M13mp8sequencesfrom nucleotides 6935to 6884.

SLM MP8 and SLM MP8R containessentiallythecloning region from M13mp8, in opposite orientations. M13mp8 replicative form DNA was digested withBamHI, the ends were made flush with Klenow enzyme, andthen the mole-cules were religated. This was done to destroy theBamHI site, as future transfection experiments require a single BamHI site in the polyomavirus genome. These molecules wereusedtogeneratewhiteplaqueson alawnofJM103cells

(31) (phage M13mp8 gives blue plaques under the same

conditions), demonstrating the +1 frameshift in the lacZ coding region. Thesephageswerethen propagated,andRF 200

eorly RNA

4900

3'

3'

on November 10, 2019 by guest

http://jvi.asm.org/

molecules were isolated and cut with HindIlI and EcoRI,

and the ends made flush with Klenow enzyme. The small

fragmentwasligated into BclI-cut, phosphatase blunt-ended ALM DNA.

Plaque assays. Plaque assays (13) were done in 35-mm

petri dishes seeded 24 h before infection with 105 3T3 cells.

Cells were transfected with 0.1 to 1 ,ug of ligated

BamHI-digested recombinant plasmid DNA by the DEAE-dextran

method (29) followed by an agar overlay. Wild-type and mutant (ALM or SLMs) DNAs were used in these assays.

Dishes were examined for plaques from 5 to 12 days after

transfection.

Immunofluorescence. Immunofluorescence assays were donewithNIH 3T3 or 3T6 cells which had been transfected with 0.1 to 0.5 ,ug of mutant or wild-type DNAs by the

calcium phosphate technique (16) as modified by Wigler et al. (46)andwith aglycerol shock(33). Alternatively, similar resultswere obtainedwhentransfections were done by the DEAE-dextran method (29) immediately after which the

cells were shocked for 1 min with 20% glycerol in HEPES

(N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic

acid)-buffered saline. One day before transfection cells were

platedat 2 x 105/60-mmdish. Dishes contained glass cover

slips. The DNAs used were first digested with BamHI to

release the viralgenome from pBR322 sequences and then

recircularized withDNAligase to reconstruct intact, infec-tious polyomavirus genomes. At the times indicated

posttransfection, coverslipswereremoved andrinsedonce

with PBS lacking calcium andmagnesium (PBS-; 144 mM

NaCl, 2.7 mM KCl, 15 mM sodium phosphate, pH 7.4).

They were then fixed for 5 min at -20°C with methanol-acetone (1:3), drained, andallowed to dry. They were then washed once with 5% goat serum in PBS- followed by an

H20

wash. Stainingwithprimary antibodywas donefor 30 min at23°C. Next, two washes with 5% goat serum in PBS-weredonefollowed by two washes with PBS-. Fluorescein-conjugated secondary antibody was added and allowed to

incubate for 30 min at 23°C. Finally, slides were washed three times with PBS-, once with H20, and then mounted with glycerol and examined under a fluorescence micro-scope.

The burst assay basically followed the procedure for

immunofluorescence assayswithNIH3T3cells. Cells were

plated1daybeforeoncoverslips,at4 x

105

cells per60-mm

plate.At30 hposttransfection, onecover slip was removed and stainedforlarge Tantigenas apreburstcontrol.At 3 and 5days staining for largeT wasdone to detect bursts. It was

helpful to include a wild-type transfection to control for

density of cells which might affectburst size.

Analysis of RNA levels. Each 90-mm culture dish, seeded with 8x

i05

NIH3T3cells 24 h before, wastransfectedwith 15 ,ugof BamHI-digested, recircularized plasmid DNA by thecalcium phosphate coprecipitation method(16) as

mod-ifiedby Wigleret al. (46) and followed by a glycerol shock

(33). Cytoplasmic RNA was isolated by the method of

Favaloro et al. (9) except that polyadenylated RNA was

further purified by affinity chromatography with poly(U)

covalently bound to diazo-thiophenyl paper obtained from Amersham(47). Thisprocedureshould also remove all small DNAoligonucleotides producedby DNase I treatment at an earlier step in the purification. Polyadenylated RNA from one90-mmplateof cells waspurifiedwith 1 cm2ofpoly(U) paper as instructedby the manufacturer. Carrier yeast tRNA

(20

ptg/ml)

was addedtothepolyadenylated RNA in water,

andthis was ethanol precipitatedandstored at -20°C until use. One-tenth of each polyadenylated RNA sample was

suspended in 0.5

,ll

of 25 mM NaH2PO4, pH 7.2. This was

transferred to GeneScreen Plus (New England Nuclear Corp.) with a hybri-slot manifold slot blot apparatus (Be-thesda Research Laboratories, Gaithersburg, Md.). Filters were treated for hybridization as described by Church and Gilbert (3). DNAprobes used in hybridization were prepared

essentially as described by Feinberg and Vogelstein (10). DNA was cleaved withApaI, BamHI, and EcoRI.

Electro-phoresiswas done in a 1% low-melting-temperature agarose minigel in Trisacetate buffer with 1 ,ug of ethidium bromide per,ul. A 1,371-bp fragmentcorresponding topolyomavirus nucleotides4632 to3261 (late probe) and a 1,051-bp fragment

(nucleotides 1560 to 2611) (early probe) were excised from the gel. H20was then added at a ratio of 3 ml of H20 per g of gel, and the samples were boiled for 7 min to melt the agarose and denature the DNA fragments. Labeling with

[ci-32P]dATP

and random-sequence synthetic hexadeoxy-nucleotides (made with a Systec model 1450 DNA synthe-sizer and thephosphoramidite chemistry) were asdescribed previously (10). Quantitation of RNA was done by densito-metric scanning of the slot-blotautoradiograms.

RESULTS

Construction and analysis of abbreviated leader mutant ALM. As a first step in examination of the function of the late leader, we deleted the sequences between the BcII site

(nucleotide 5026) and the Hinfl site (nucleotide 5073) in a

polyomavirus-pBR322 recombinant molecule. This

con-structionthuscarriesadeletion of 48 of the original 57 bases of the leader exon and yields a viral genome with a 9-base leader sequence (Fig. 1A). This abbreviated leader mutant (ALM)maintainsauniqueBclI site and 3 bpjunctionalto the

leader-leadersplice acceptor site at the 5' end of the leader exon and 6 bpadjacentto the splicedonor site at the 3' end of the leader. Thelocalizationof thedefect in the mutant was

confirmed by cloning a wild-type BclI-BgIl fragment into ALM which restored viability. Also, the sequence of this

fragment from ALM was verified by subcloning into

bacteriophage M13mp8DNAfollowed bydideoxy

sequenc-ing.

To test for viability, we transfected NIH 3T3 cells with

BamHI-liberatedALMgenomesfrom therecombinant plas-mid or with wild-type polyomavirus genomes similarly cut from recombinant molecules. In repeated attempts ALM

failed to produce plaques in a plaque assay, while cloned wild-type polyomavirus DNA consistently gave 50 to

60

plaques per 100 ng in the same assay. ALM was next

examined to determine whether early viral functions were normal. Indirectimmunofluorescence was used todetermine whether NIH 3T3 cells transfected with BamHI-linearized

ALM DNA produced intranuclear large T antigen. The

results areshown inFig. 2. Similar levelsofpositive nuclei

were observed with ALM, and pPy, indicating that large T antigen is produce.d in the abbreviated leader mutant. As another measure of early gene expression (this time middle T

antigen), the entire ALM plasmid was used to transform Fisher ratF-111 cells. Results were similar to those with the wild-type (59RA) control plasmid, pPy (Table 1). DNA replication assays (data not shown) indicated that the ALM

BamHI-linearized DNA was replicatedto the samelevel as pPy

BamHI-linearized

DNA at 30 h posttransfection. To demonstrate conclusively that the defect in ALM is not in early gene expression or replication, we performed mixed DNAtransfections with ALM and acloned early-defective

helper DNA(lacking the

XbaI

fragment,nucleotides2477 to

on November 10, 2019 by guest

http://jvi.asm.org/

30

hrs

anti-T

30

_anti-VP1

hrs

PPY

[image:4.612.63.557.76.421.2]

ALM

FIG. 2. Immunofluorescence localization of earlyandlate viralproteinsafterDNAtransfections.PlasmidDNAs pPy(wildtype)andALM

werecutwithBamHI,and polyomavirus genomes wererecircularized withDNAligaseandtransfectedby the DEAE-dextranmethod into

mouse3T3cells. At 30h aftertransfection, coverslipswerefixed andreacted with eitherratanti-Tserum(early)orrabbitanti-VP1serum

(late).Fluorescein-labeled secondary antibodywasusedtoallowvisualizationof viralantigens. 2522; unable to produce fully functional large T antigen).

Thismixedtransfectiongaveplaquescontainingamixture of

the complementing defective genomes. This mixed virus stock yielded plaques in 6to 7days,asdidwild-type virus. These plaques were picked and amplified, and the virus stockswereused forproductive infections. After isolation of

low-molecular-weight DNA and restriction enzyme diges-tion, it was seen that the ALM and helper genomes were presentinapproximately equalamounts(datanotshown). It should be noted that this finding eliminates the possibility that ALM is nonviable because the deleted sequence con-tains aDNA-packagingsignal.

Indirectimmunofluorescencewithantiseraspecific forlate proteins was next done to determine whether late gene expressionwas normal in the mutantlate after DNA trans-fection. AlthoughNIH3T3 cells transfected withwild-type

cloned DNA gave up to 5% positive nuclear fluorescence withanti-VP1serum,nopositiveswere even seenwith ALM

(Fig. 2). Resultsweresimilar whenacombined antiserum for

theothertwoviral lateproteins, VP2 and VP3, was used. RNAanalysis was done to evaluatefurther the defectin ALM. Aslotblot ofpolyadenylated cytoplasmic RNA from ALMandpPy viral DNA-transfected cellswasdone(Fig. 3).

For theseblots 5to10timesmoreALM RNA thanwild-type

RNAwas applied to the slot-blot apparatus to show more

clearly the nature of the ALM defect. ALM has been shown to be indistinguishable from wild-type viral DNA in early gene expression and DNA replication after DNA transfec-tion. For this reasonhybridization of RNA to an internally labeledprobe specificforearlyRNA wasused to control for transfection efficiency and RNA recovery from the transfected cells. An identical blot ofpPy and ALM

poly-adenylated cytoplasmicRNA washybridizedto aninternally labeled probe specific for late RNA. Thus, although the

signal of early polyomavirus RNA from ALM-transfected

TABLE 1. Transformation ofF-111 cellsbypPy and ALM'

Plasmid AmtofDNA(jig) No.offoci

pPy 0.1 35,24,35

1.0 38,53, 48,60

ALM 0.1 15,25, 20,30

1.0 43, 58, 65, 41

Control 0 0,0

a106cellsper90-mmdishweretransfected withtheindicatedquantitiesof

plasmid DNA,asdescribed in Materials and Methods. Fociwerecounted at 14days.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:4.612.320.561.617.698.2]

Cytoplasmic

poly)

pPy

9 1

Early Probe

Late Probe

.i

I.

i..

FIG. 3. Slot-blot analysis of early and latecyt viral RNA after transfection of NIH 3T3 cellsw

DNA. RNA was preparedas described inMateri and applied to the slot-blot manifold in two d (relativeamounts,9 and1).Thefilterswerehybrid late specific32P-labeledprobes andsubjectedto a cells was considerably more intense than f same samples the opposite was true when

probed (Fig. 3). Densitometric scanning of

vealed that minimally there is a 200-fold red polyadenylated late RNA accumulated in th

transfected cells.

Analysis of substituted leader mutants ('

spliced correctly the leader inALMwouldb

A

Wild Type (59RA)

.AAG(AGUCGGGAGGAAALMACUGUGUUGGAGGCCCtICcGCCAUUCGcUGAUCAA)GUA.

Abbreviated Leader Mutant(ALM)

..AAG(AGU...deletlonof nt 5026-5073.*-GAUCAA)GUA..

+ ninenucleotides)thatSImapping to examineleadersplicing

A~

mRNA would probably not work. Therefore, in an effort to con-struct a variant that would be easier to study, several

substituted leader mutants(SLMs) were created by inserting ALM variousshort

procaryotic

sequencesinto theunique

IclI

site

of ALM. This restored nearly correct length leaders and 9 would also be agood control for the change in spacing of regulatory elements in the DNA of the deletion

mutant

& & ALM. The leader sequences ofsome of these mutants are

3 s shown inFig. 4. To oursurprise,manyofthesewere viable, twoof whichgave plaqueson NIH 3T3 cellswith the same

kinetics aswild-type pPy DNA.

Alternate method to determine virusviability. Anempirical findingis that when NIH 3T3 cells aretransfected with viral

DNA and stained at 48 hfor large T antigen, occasionally

toplasmic polyA+ dense clusters of 60 to 100 positive nuclei are observed.

iith pPy or ALM These have been assumed to be viral bursts which would ials and Methods occurwhen transfected cells lyseproducing virus that

sec-lifferent amounts ondarily infects surrounding cells. When staining isdone at

lized

with

early

or 3 and 5 days posttransfection, virtually all that is seen is

Lutoradiography. bursts. This method was used to test the substituted leader

mutantsforviabilityasit wasfaster than the standardplaque

or pPy, for the assay and

potentially

more sensitive. Indirect

immunofluo-late RNA was rescenceforlarge T wasdoneat3 and also 5daysso as not such blots re- tomiss variantsthatmightbe slowgrowing. Figure5 shows

luction in ALM results from atypical burst assaydone here with wild-type

ie cytoplasm of pPy and with ALM. At day 1 bright

positive

nuclei were presentfor bothDNAs. Atday5pPy-transfected cellswere SLMs). If it is positive for bursts whiletheALM-transfected cells showed

Fe soshort(only no evidence of virus

production

and reinfection. This

sup-B

VIRUS

LEADER

LENGTH

59RA (WT)

--It

SLM/MP8 (M13mp8 cloning region inserted)

..AAG(AGUGAUCAGCtUGGCUGCAGGUCGACGGAUCGAUCCCCGGGAAUUGAUCAA)GUA..

SLM/MP8R (Ml3mp8 cloning region,other orientation)

..AAG(AGUGAUCAAUUCCCGGGGAUCGAUCCGUCGACCUGCAGCCAAGCUGAUCAA)GUA_

SLM Y(yeastspacer insert)

..AAG(AGUGAUCUGACAAGCGUUUGCGAAGCUCCUGAAUCAAUAAGAAGGUGAUCAA)GUA-SLMC(Ml3mp8spacer insert)

..AAG(AGUGAUCCGUUUUUAUUUUCAUCGUAGGAAUCAUGAUCUACAAAGGCUAUCAGGUCAUUG

CCUGAGAGUCUGGAGCAAACAAGAGAAUCGGAUCAA)GUA..

SLM B (pBR322 spacer insert, nt3736-3671)

-AAG(AGUGAUCGGAGGACCGAAGGAGCUAACCGC ACAACAUGGGGGAUCAUGUAAC UCGCCUUGAUCAA)GUA..

SLMM (pBR322 spacer insert,nt 3736-3689)

..AAG(AGUGAUCGGAGGACCGAAGGAGCUAACCGCUUUUUUGCACAACAUGGGGGAUCAA)GUA.

SLM/MP8 MlSm0 cloning reion

SLM/MP8R l-bl13mps cloning region \

SLMY

-N

yeastepcw insr

En]

SLM MR (pBR322 spacer insert, nt 3689-3736)

..AAG(AGUGAUCCCCCAUGUUGUGCAAAAAAGCGGUUAGCUCCUUCGGUCCUCCGAUCAA)GUIA SU1 C -Li

AUG M13mp spacerInsert

SLMB -N pBR322 AUG AUG KNt

FIG. 4. Mutants in the late leader. (A)The top line shows the sequence of the wild-type leader unit along with several flanking bases.ALMwasconstructedasdescribed in MaterialsandMethods bydeleting sequencesbetweentheBclI siteatnucleotide (nt)5021 SLM M and theHinflsiteatnucleotide5076.Thesubstitutedleadermutants

wereconstructed byinsertingDNAfragmentsinto the unique

Bc(I

siteretainedbyALM.(B) Schematicrepresentation ofthe mutants. AUG codons areindicated. WT, wildtype. SLMMR

-IN pBR322

73 nt

55 nt

AUG

s\ N ALM

57 nt

9 nt

51 nt

51 nt

52nt

9l\\I-6

nt

pBR322 &\ 55 nt

----H.AUQ

on November 10, 2019 by guest

http://jvi.asm.org/

[image:5.612.57.297.76.220.2] [image:5.612.59.568.391.728.2]

30

HRS

120

HRS

PPY

ALM

FIG. 5. Burst assay to test ALMforviability. Plasmid DNAs frompPy(wildtype) and ALM were cutwithBamHI,andpolyomavirus genomes wererecircularized withDNAligaseandtransfectedbytheDEAE-dextranmethodintomouse3T3cells.Atdays1and 5coverslips werefixedandstained with rat anti-T serumfollowed byfluorescein-labeled secondaryantibody.

ports the plaque assay finding that ALM is nonviable.

Evidently

by day5transient expression of largeTislargely undetectable forALM (and presumably pPy). Burst assays were alsoused to test substituted leader mutants for

viabil-ity. Figure 6shows examples of

bursts

for pPy, SLM MP8,

and SLM B. Note

that

there is an inverse correlation between sizeofburstandlength of timerequired to produce

plaquesinplaque assays (Table 2). Because of the small size

ofthebursts with someof the mutantstrains, itishelpfulto

transfect withlow levelsofDNA.That way, even at3days,

groups of four to six positives are definitely due to viral burstsand notchance clusters of cellstransientlyexpressing large T antigen. Note that all constructions that did not produce plaques were also negativein the burst assay.

DISCUSSION

We constructed and studied a group of polyomavirus mutants with altered late leader sequences. The 9-base

abbreviatedleadervariant, ALM, isnonviable and doesnot produce detectable late proteins or detectable cytoplasmic late mRNA, indicatingthat the leader is necessary for late gene expression. Restoration of viability (and late gene

expression) by insertion of arbitrary sequences into the ALM abbreviated leader suggests thatamajor leader

func-tionisasaspacer (onthe DNA or RNAlevel). Toreiterate, the spatial setup of the leader region is important but the actualleader sequence is not, at least for the 48 bases deleted in ALM.

Early speculations on polyomavirus late leader function

(23, 24, 41) and numerous studies of mRNA 5' leaders in general have proposed a role for leaders in control of mRNA translation. One example is in adenovirus type 5: the dele-tion of the 5' tripartite late leader results in a fivefold decrease in translation efficiency ofarecombinant message (26). The polyomavirus wild-type late leader has apurported ribosome-binding site (23), no internal AUGs, and aregion

complementary to the 3' end ofmouse 18S rRNA (38). A translational control model for polyomavirus late messages would suggest that the leader sequence promotesribosome binding and thus late mRNA translation. Tandem leaders would potentiate this effect. Ouroriginal finding that ALM was nonviable supports this model, butourlater results do not.

When growth characteristics of the substituted leader mutants were examined, it became apparent that the nature of thelate leader could indeed affect late geneexpression but generally not in any unexpected manner. SLM M and SLM MR create leaders ofnearwild-typelength. Both,however, containAUG codons with no in-frame termination codons in the new leaders. Normally, the5'-most AUGs in eucaryotic mRNAs are used for translational initiation. Studies have shown(22, 25) that if an additional AUG is inserted 5' to the original start codon, inhibition of translation from the down-streamAUG results. In SLM M and SLM MR this would be expected to cause the formation of a late translational frameshift and lower levels ofcorrectly initiated wild-type

on November 10, 2019 by guest

http://jvi.asm.org/

[image:6.612.70.557.71.400.2]

Ppy

SLM/MP8

I

SLM B

FIG. 6. Characteristic bursts for wild type andtwosubstituted leadermutants.Methodswere asdescribedin thelegend forFig. 6, but staining was doneat 3days after transfection with the DNAs.

polypeptides. Not all of these AUGs have surrounding

sequences which obey the consensus for translational

initi-ation (21). However, since they will presumablybe present

multiple times in most late mRNAs ofthese viruses, any negative effect on translation will be multiplied.

It has been demonstrated (22, 25) that when an in-frame

termination codon is inserted after an "artificial" 5'-most

AUG, translation again occurs at the original downstream start codon atclose to wild-type levels. Sequence datafor SLMBandSLMC inFig.5reveal thatthismaybethecase

forthe leadersinthese variants.Asonemight predict, SLM

B and SLM C are both viable but produce plaques more

slowlythan thewildtypedoes.Itshouldbe noted thatSLM

B has twoleader AUGs within 9bases of each other, with only one having an in-frame terminator. This somewhat

complicates ourexplanation forviability ofthis mutant.

Finally, SLM MP8 and SLM MP8R(withthesameleader

insertbutintheopposite orientation)have nointernalleader

AUGs,aleaderlength of51bases,andproduce plaqueswith the same kinetics as wild type. These, along with SLM Y, are the three examples of AUG codon-free substituted leaders that were tested. Whether theidentity ofthe leader sequence,outsideof being AUG-free,is irrelevant togrowth

in tissue culture requires the study of more substituted

TABLE 2. Plaque assays oflateleadermutants"

Virus Time of appearance of

plaques (days)

pPy (WT)... 6-7 ALM... Nonviable

SLM MP8...7...67 SLM MP8R... 6-7 SLMY ... 6.5-7.5 SLM C ... 9-10 SLMB ... 9-10 SLMM... Nonviable

SLM MR... Nonviable

leadermutants.If the polyomaleader sequencedoeshavea rolein translational controlit maybesubtle or not sequence

specific.The 48bases deletedinALM removethepurported

ribosome-protected region (23) and the 10 bases which are somewhat complementary to the 3' end of 18S rRNA (38). These arereplaced withother sequences in theviable SLMs.

Our results do notsupporta primarytranslational defect in ALM.Rather,ALMisalmostcertainly defective because of

its deficiency inlate cytoplasmic mRNA. Late mRNAwith

an abbreviated leader may, however, additionally be trans-lated poorly. One might speculate that mRNA which is translated poorlyis less stable inthecytoplasm, but results with two typesofadenovirusmutantsaffected in late mRNA

translation do not show this (26, 40).

Simian virus 40 (SV40), another papovavirus, resembles

polyomavirusin itsmode of late geneexpression.A common 5' leader is found in some form on all late mRNAs. Also similar is theheterogeneity ofthe 5'endsoflate mRNAs and the dependency on large T antigen for late transcription

initiation. It isdifficult, however, to apply resultsfrom SV40 to polyomavirus. Unlike polyomavirus, the late leader in

SV40 mRNA is over 240 bases long, is not repeated, contains internal splice sites, and codes for a protein, the

agnoprotein (14, 15, 20, 30, 36). A large numberof viable

leader deletion mutants of SV40 have been reported (36). Some shifting upstreamoflate mRNA startsites occurs in some ofthese mutants, and many lack internal splice sites (34, 35). Somasekhar and Mertz (39) have recently shown

thatbydeletingoneSV40 late leaderintron splicedonor site orbymakingan insertionin the same area, the patternof5' RNAstartsiteschanges.Thefrequencyofsplicingatsplice

donor and acceptor sites hundreds of bases away is also affected.

Althoughthere isnoprecedencefordownstream promoter elementsin SV40 late genes, ourresultsareconsistent with the leader functioning on the DNA level as a necessary spacer between two promoter elements. Onecan speculate

that without the leader region present late transcriptional

initiation could be inhibited oraltered. This might resultin decreased steady-state levels ofALM cytoplasmic mRNA

owingto decreased initiationorincreased degradation.

aPlaque assays were done on NIH 3T3 cells with DNAs excised from

recombinant plasmids and recircularized with DNAligase asdescribed in Materials and Methods.WT,Wildtype.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:7.612.66.555.76.276.2]

Anothermodel for the ALM defect is that the lesion is in RNA splicing, resulting in an inability to form mature cytoplasmic mRNA molecules. The late leader in polyoma-virus may simply function as a spacer to allow efficient splicing for removal of genome-length introns. In ALM the leader contains 9 bases between the leader splice acceptor siteand the leadersplice donor site. The deletion is in the exon; intron sequences and splice junctions are intact. Unlikeintrons, which showconsensus sequences and mini-mal sizesfor function (80bases in a rabbit,B-globinmessage)

(45), exon requirements for splicing are not well defined. Maybe splicingcannot occur in thissystembecause strong splice donor and acceptor sites are so close together. It is

possible that a short exon would inhibit proper splicing

owing to steric hindrance ofthe splicing machinery. If in ALMtheleader-to-leader splicesandleader-to-bodysplices for mVP1 andmVP3 occur at very lowlevels, nonviability of

this virus would be explained. Increasingthe leaderlengthin ALM to 51bases (SLMMP8) and to even greater lengths in otherconstructions might create an exon larger than what may be a minimum length requirement for splicing in this system.

At this time it is not clear whether the primary defect in ALMisat the levelofRNAsynthesis,processing, transport, or degradation. An examination of late RNA produced by mutant ALM is under way to determine rates of RNA

synthesis(not steady-state levels) and whether RNAsplicing

is occurring efficiently. These studies should reveal more

clearlythe natureof the spacer function of thepolyomavirus

late leader.

Finally,avirus relatedtopolyomavirus hasbeen isolated fromhamsters(6). It will be of interest to learn whether the hamsterpapovavirus also directsthe synthesis of giantlate

nuclear RNAsand tandem late leader units.

ACKNOWLEDGMENTS

WethankHermanWolf forhelp withsomeofthefiguresandJanice Seagren for typingthemanuscript.

Thisworkwassupported by Public Health ServicegrantCA32325 from the NationalCancerInstitute,agrant-in-aid from the American HeartAssociation, andagrantfromtheAmerican CancerSociety. G.C. isanEstablishedInvestigator oftheAmericanHeart Associ-ation. Theoligonucleotide synthesizerwaspurchased withmatching funds fromtheDepartment of Defense.

LITERATURE CITED

1. Acheson,N. 1978.PolyomagiantRNAscontain tandem repeats of the nucleotide sequence of the entire viral genome. Proc. Natl. Acad. Sci. USA 75:4754-4758.

2. Acheson, N. 1976. Transcription during productive infection withpolyoma virusandsimian virus40.Cell8:1-8.

3. Church, G.,and W.Gilbert. 1984. Genomicsequencing.Proc. Natl. Acad. Sci. USA 81:1991-1995.

4. Cowie, A.,C. Tyndall, andR. Kamen. 1981. Sequencesatthe capped5'-ends ofpolyomavirus lateregionmRNAs:an

exam-ple of extreme terminal heterogeneity. Nucleic Acids Res. 10:6305-6322.

5. Dailey,L., and C. Basilico. 1985.Sequencesin thepolyomavirus DNA regulatory region involved in viral DNAreplication and earlygeneexpression. J. Virol. 54:739-749.

6. Delmas, V.,C. Bastien,S.Scherneck,andJ.Feunteun. 1985.A new member of the polyomavirus family: the hamster papovavirus. Completenucleotide sequence andtransformation properties. EMBOJ. 4:1279-1286.

7. deVilliers, J., L. Olson, C. Tyndall, and W. Schaffner. 1982. Transcriptional "enhancers" from SV40 and polyoma virus showacell typepreference. NucleicAcids Res. 10:7965-7976. 8. deVilliers, J., and W. Schaffner. 1981. A small segment of

polyoma virus DNA enhances the expression of a cloned

P-globin

gene over adistance of 1400 base pairs. Nucleic Acids

Res. 9:6251-6264.

9. Favaloro, J., R. Treisman, and R. Kamen. 1980.Transcription maps of polyoma virus specific RNA: analysis by two-dimensional nuclease S1 gel mapping. Methods Enzymol. 65:718-749.

10. Feinberg, P. F., and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13.

11. Feunteun, J., L. Sompayrac, M. Fluck, and T. L. Benjamin. 1976. Localization of gene functions in polyoma virus DNA. Proc. Natl. Acad. Sci. USA 68:283-288.

12. Flavell, A. J., A. Cowie,S. Legon, and R. Kamen. 1979.Multiple 5'-terminal cap structures in late polyoma virus RNA. Cell 16:357-372.

13. Fluck, M., and T. L.Benjamin.1979. Comparison oftwoearly gene functions essential for transformation in polyoma virusand SV40.Virology 96:205-228.

14. Ghosh, P., V. Reddy, J. Swinscoe, P. Choudry, P. Lebowitz, and S. Weissman. 1978. The5'-terminal leader sequence of late 16S mRNAfrom cells infected with simianvirus40. J.Biol. Chem. 253:3643-3647.

15. Ghosh, P., V. Reddy, J. Swinscoe, P. Lebowitz, and S. Weis-sman.1978.Heterogeneityand 5'-terminal structures of the late RNAs of simianvirus 40. J. Mol. Biol. 126:813-846.

16. Graham, F. L., and A. J. van der Eb. 1973. A new techniquefor the assay ofinfectivity ofhumanadenovirus5 DNA. Virology 52:456-467.

17. Heiser, W. C., and W. Eckhart. 1982. Polyomavirusearlyand latemRNAsinproductively infectedmouse3T6cells.J.Virol. 44:175-188.

18. Herbomel, P., B. Bourachot, and M. Yaniv. 1984. Two distinct enhancers with different cellspecificitiescoexist in the regula-toryregion of polyoma. Cell39:653-662.

19. Hirt, B. 1969. Selective extraction of polyoma DNA from infectedmouse cell cultures.J. Mol. Biol.26:365-369. 20. Jay, G., S. Nomura, C. W. Anderson, and G. Khoury. 1981.

Identification of the SV40 agnogene product: a DNA binding protein. Nature(London)291:346-349.

21. Kozak, M. 1981. Possiblerole offlanking nucleotides in recog-nition of the AUG codon by eukaryotic ribosomes. Nucleic AcidsRes. 9:5233-5252.

22. Kozak, M. 1984. Selection of initiation sites by eucaryotic ribosomes: effect ofinserting AUG triplets upstreamfrom the coding sequence for preproinsulin. Nucleic Acids Res. 12:3873-3893.

23. Legon, S. 1979. Binding of ribosomestopolyoma virus RNA. Possibleroleof the leaderregion ininitiation siterecognition.J. Mol. Biol. 134:219-240.

24. Legon,S.,A.Flavell, A. Cowie, and R. Kamen. 197. Amplifica-tionin the leader sequenceof latepolyoma virusmRNAs.Cell 16:373-378.

25. Liu,C.-C.,C. C.Simonsen,and A. D. Levinson.1984.Initiation of translation at internal AUG codon in mammalian cells. Nature(London)309:82-85.

26. Logan, J., and T. Shenk. 1984. Adenovirus tripartite leader sequenceenhances translation of mRNAs late after infection. Proc.Natl. Acad. Sci. USA 81:3655-3659.

27. Luthman, H., M. G. Nilsson, andG. Magnusson. 1983. Non-contiguoussegments of thepolyomagenomerequired in cisfor DNAreplication.J. Mol. Biol. 161:533-550.

28. Maniatis, T., E. Fritsch, and J. Sambrook. 1982. Molecular cloning,alaboratory manual. ColdSpringHarborLaboratory, ColdSpring Harbor, N.Y.

29. McCutchan, J., and J. Pagano. 1968. Enhancement of the infectivity of simian virus 40 deoxyribonucleic acid with diethylaminoethyl-dextran. J. Natl. CancerInst.41:351-356. 30. Mertz, J., A.Murphy,and A.Barkan.1983. Mutantsdeleted in

the agnogene of simian virus 40definea newcomplementation group. J. Virol. 45:36-46.

31. Messing, J. 1983. New M13 vectors for cloning. Methods

on November 10, 2019 by guest

http://jvi.asm.org/

Enzymol. 101:20-78.

32. Muller, W. J., C. R. Mueller, A. M. Mes, and J. A. Hassell. 1983. Polyomavirus originfor DNA replication comprises mul-tiple genetic elements. J. Virol. 47:586-599.

33. Parker, G., and G. Stark. 1979. Regulation of simian virus 40 transcription: sensitive analysis of the RNA species present earlyin infections by virusorviralDNA. J. Virol. 31:360-369. 34. Piatak, M., P. K. Ghosh, L. C. Norkin, and S. M. Weissman. 1983. Sequences locating the5' endsof the major simian virus 40latemRNAforms.J. Virol.48:503-520.

35. Piatak, M., K. N. Subramanian, P. Roy, and S. M. Weissman. 1981. Late messenger RNA production by viable simian virus 40 mutants with deletions in the leader region. J. Mol. Biol. 153:589-618.

36. Reddy, V., P. Ghosh, P. Lebowitz, and S. Weissman. 1978.Gaps and duplicated sequences in the leaders of SV40 16S RNA. NucleicAcids Res. 5:4195-4213.

37. Ruley, E., and M. Fried. 1983. Sequence repeats in a polyomavirus DNA region important for gene expression. J. Virol.47:233-237.

38. Soeda,E., J. Arrand, N.Smolar, J. Walsh, and B. Griffin. 1980. Coding potential and regulatory signals of the polyomavirus genome.Nature(London)283:445-453.

39. Somasekhar, M., and J. Mertz. 1985. Exon mutants thataffect the choice of splice sites used in processing the SV40 late transcripts. Nucleic AcidsRes. 13:5591-5609.

40. Thimmappaya, B., C. Weinberger, R. J. Schneider, and T.

Shenk. 1982. Adenovirus VAI RNA is required for efficient translation of viral mRNAs at late times after infection. Cell 31:543-551.

41. Treisman, R. 1980. Characterization ofpolyoma late mRNA leader sequences by molecular cloning and DNA sequence analysis. NucleicAcidsRes. 8:4867-4888.

42. Treisman, R., and R. Kamen. 1981. Structure of polyoma virus late nuclear RNA. J.Mol. Biol. 148:273-301.

43. Tyndall, C., G. LaMantia, C. Thacker, and R. Kamen. 1981. A region ofthe polyoma virus genome between the replication origin and late protein coding sequences is required in cis for both early gene expression and viral DNA replication. Nucleic AcidsRes. 9:6231-6250.

44. Veldman, G., S. Lupton, and R. Kamen. 1985. Polyomavirus enhancer contains multiple redundant sequence elements that activate both DNA replication and gene expression. Mol. Cell. Biol.5:649-658.

45. Wieringa, B., E. Hofer, and C. Weissman. 1984. A minimal intronlength but no specific internal sequence is requiredfor splicingthelarge rabbit 1-globin intron. Cell 37:915-925. 46. Wigler, M., A. Pellicer, S.Silverstein,R.Axel, G.Urlab, and L.

Chasin. 1979.DNA-mediated transfer oftheadenine phospho-ribosyltransferase locus into mammalian cells. Proc. Natl. Acad. Sci. USA 76:1373-1376.

47. Wreschner, D. H., and M. Herzberg. 1984. A new blotting medium for the simple isolation and identification of highly resolved messenger RNA. Nucleic Acids Res. 12:1349-1359.

on November 10, 2019 by guest

http://jvi.asm.org/