Cell-SELEX
Generating Cell Targeting Aptamers for Nanotheranostics Using Cell-SELEX
... of SELEX is to distinguish the target-binding sequences from unbinding ...for cell-SELEX, partitioning is relatively simple, essentially because the unbound sequences can be easily removed by ...
13
Utilizing Cell-SELEX, as a Promising Strategy to Isolate ssDNA Aptamer Probes for Detection of Staphylococcus aureus
... whole cell. Performing consecutive Cell-SELEX rounds is aimed to increase the affinity and proprietary performance of ...the SELEX process will confirm and veri- fy the accuracy of ...
6
CD109 is identified as a potential nasopharyngeal carcinoma biomarker using aptamer selected by cell-SELEX
... cancer cell- Systematic Evolution of Ligands by EXponential enrichment (cell-SELEX) procedure and aptamer-based purification approach was ...Using cell-SELEX procedure, four aptamers ...
15
Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX
... meningitidis cell surface and other bacterial pathogens like Salmonella typhimurium [18,19] , Campylobacter jejuni [26] , Mycobacterium tuberculosis [24] , Staphylo- coccus aureus [23] , Streptococcus pyogenes ...
9
APTAMER: A MIRACLE TOOL FOR TARGETED DRUG DELIVERY
... Aptamers are rapidly maturing into therapeutic tools with commercial potential. Given that aptamers mimic and extend many features of monoclonal antibodies (mAbs), they have the potential to make an impact in molecular ...
9
Specific detection of Shigella sonnei by enzyme-linked aptamer sedimentation assay
... To our knowledge this is the first report of suc- cessful generation of DNA aptamers that bind specifically to S. sonnei, using a whole bacterial cell-SELEX. This approach, relying on using whole cells ...
5
Evaluation of the clinical value of ELISA based on MPT64 antibody aptamer for serological diagnosis of pulmonary tuberculosis
... ligands. SELEX can be used to select high affinity aptamers against target ligands and to obtain specific aptamers from an in vitro pool of random ...aptamers. SELEX methods have improved drastically in ...
8
An Aptamer-Based Probe for Molecular Subtyping of Breast Cancer
... in RPMI-1640 (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA). MDA-MB-231 cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco, USA) supplemented with 10% fetal bovine serum. MCF-10A cells ...
12
Development of Molecular-based Methods to Capture and Detect Salmonella and Campylobacter in Complex Sample Matrices
... whole-cell SELEX method was used for aptamer selection as an alternative to the more traditional SELEX approach applied to crude or purified extracellular surface ...Whole-cell SELEX or ...
190
Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery
... called SELEX (Systematic Evolution of Ligands by Exponential enrich- ment) [7-11], DNA or RNA aptamers specific for a known protein of interest can be selected from a random pool of oligonucleotide sequences, and ...
14
TRIM2 downregulation in clear cell renal cell carcinoma affects cell proliferation, migration, and invasion and predicts poor patients’ survival
... RCC is a common and lethal urological malignancy in adults. ccRCC is accounting for ~80% of all RCC histological sub- type and has the highest rate of mortality, invasion, metastasis, and resistance to traditional ...
14
Structural Plasticity and Rapid Evolution in a Viral RNA Revealed by In Vivo Genetic Selection
... Interestingly, these experiments revealed that alteration of the H4a loop could complement mutations in the upstream DR element (Fig. 3). Prior results implicated the DR element as critical for satC transcription in ...
13
Resolving the SELEX–LHCb double-charm baryon conflict: the impact of intrinsic heavy-quark hadroproduction and supersymmetric light-front holographic QCD
... The SELEX experiment was a fixed-target experiment utilizing the Fermilab negative charged beam at 600 GeV/c to produce charm particles in a set of thin foil of Cu or in a diamond and was operated in the kinematic ...
6
Vasorin is a potential serum biomarker and drug target of hepatocarcinoma screened by subtractive-EMSA-SELEX to clinic patient serum
... We report a new biomarker of hepatocarcinoma, vasorin (VASN), screened by a subtractive EMSA-SELEX strategy from AFP negative serum of hepatocellular carcinoma (HCC) patients with extrahepatic metastases. VASN was ...
15
Cell matrix interactions and cell cell junctions during epithelial histo morphogenesis in the developing mouse incisor
... Yoshiba et al., 1998a, 1998b, 2000). Laminin-5 is involved in the anchorage/motility of epithelial cells through integrins α 6 β 4, α 6 β 1 and α 3 β 1 (Delwel and Sonnenberg, 1996). The BP230 was used as a marker of ...
10
Development of ss DNA aptamers for c Myc:Max by SELEX (Systematic Evolution of Ligands by Exponential Enrichment)
... The delivery procedure can be tested by monitoring the uptake of fluorescence signals from fluorescein labeled oligonucleotides. Another strategy is to use peptide-mediated delivery in an endocytic-independent way. ...
118
Single-Step Selection of Bivalent Aptamers Validated by Comparison with SELEX Using High-Throughput Sequencing
... promotes cell division.[8] A combinatorial library of single stranded DNA was incubated with the target substance and unbound sequences were eliminated by capillary electrophoresis (CE). Oligonucleotides that ...
11
Stiffness of Cell Micro-Environment Guides Long Term Cell Growth in Cell Seeded Collagen Microspheres
... of cell micro-environment cannot provide all the necessary signals for full osteogenic commitment of hES-MPs and the role of other factors such as surface topography, porosity, mechanical and biochemical ...
16
<p>Diosmetin Inhibits Cell Proliferation, Induces Cell Apoptosis and Cell Cycle Arrest in Liver Cancer</p>
... liver cell LO2 had no signi fi cant changes after treatment with ...hepatoma cell cycle can induce the repression of liver cancer cell ...to cell cycle ...G2/M cell cycle arrest, which ...
10
DNA-Binding Specificity of the IDI-4 Basic Leucine Zipper Factor of Podospora anserina Defined by Systematic Evolution of Ligands by Exponential Enrichment (SELEX)
... Expression and purification of the IDI-4 bZIP domain. The region encoding the IDI-4 protein from residue 171 to 252 was amplified by PCR with oligonu- cleotides ZIP (5 ⬘ ATCATATGACCAAGAAACGTCCTCTGCCTG 3 ⬘ ) and 6His (5 ⬘ ...
8