direct repeat
Microevolution of the Direct Repeat Region of Mycobacterium tuberculosis: Implications for Interpretation of Spoligotyping Data
... To identify the mechanisms leading to the different poly- morphic variants, chromosomal domains adjacent to the an- cestral IS6110 insertion element as well as domains adjacent to additional IS6110 elements were cloned ...
9
Mycobacterium africanum Genotyping Using Novel Spacer Oligonucleotides in the Direct Repeat Locus
... Genotyping. DNA was extracted by a simple thermolysis method. Spoligotyp- ing using 43 spacers was performed as previously described by Kamerbeek et al. (13). The 68-spacer format with 25 novel spacers was used according ...
5
Direct Repeat Unit (dru) Typing of Methicillin Resistant Staphylococcus pseudintermedius from Dogs and Cats
... the direct repeat unit (dru), a variable- number-of-tandem-repeats region, which consists of mostly 40-bp dru repeats and is located downstream of the mecA gene and adjacent to IS431 in SCCmec elements of ...
6
Characterization of Mycobacterium tuberculosis complex direct repeat sequence for use in cycling probe reaction
... Cycling probe technology (CPT) is a unique and simple method for the detection of specific target sequences. CPT utilizes a chimeric DNA-RNA-DNA probe providing an RNase H-sensitive scissile linkage when bound to a ...
5
Preferential Deletion Events in the Direct Repeat Locus of Mycobacterium tuberculosis
... The “Harlingen” IS6110 restriction fragment length polymorphism (RFLP) cluster has linked over 100 tuberculosis cases in The Netherlands since 1993. Four Mycobacterium tuberculosis isolates that were epide- miologically ...
5
Use of Spoligotyping To Study the Evolution of the Direct Repeat Locus by IS6110 Transposition inMycobacterium tuberculosis
... the direct repeat (DR) locus of Mycobacterium tuberculosis complex organisms, spoligotyping is a rapid method that aids in the study of the epidemiology of ...
5
Sequence Analysis of the Direct Repeat Region inMycobacterium bovis
... typing of mycobacteria. In human TB, molecular typing is advanced by the use of the insertion sequence IS6110 (6, 7, 18), which is repeated many times in the M. tuberculosis genome, producing a genotypic heterogeneity of ...
6
Epstein-Barr virus DNA. X. Direct repeat within the internal direct repeat of Epstein-Barr virus DNA.
... EcoRI, which makes two nucleotide sequence, CCAGGCCAGCCGGA- cuts at the left end of BamHI-C, separates US GGGACCCCGGCAGCCCGGGCG, occurs as a components of BamHI-C from the right end of d[r] ...
7
Long internal direct repeat in Epstein-Barr virus DNA.
... Plasmids pDK10 BamHI-C, pDK51 BamHI-V, and pDK14 BamHI-V, which contain 286 Downloaded from http://jvi.asm.org/ on November 10, 2019 by guest The nucleotide sequence of the long internal[r] ...
9
cis-Acting RNA packaging locus in the 115-nucleotide direct repeat of Rous sarcoma virus.
... Figure 4, lane B, shows the Si nuclease digestion products after hybridization of the same probe to virion RNA harvested 48 h posttransfection from the culture medium of the same plate o[r] ...
9
Isolation and characterization of recombinant DNA clones of avian retroviruses: size heterogeneity and instability of the direct repeat.
... It seemed possible, therefore, that the 5.0-Md inserts in type II clones might arise by one of the two following mechanisms: i the original plaque contained two or more different recombi[r] ...
8
Somatic and germinal recombination of a direct repeat in Arabidopsis.
... By contrast, gene conversion not associated with crossing over would allow for frequent exchanges between repeated sequences with- o u t concomitant rearrangements, and [r] ...
14
Single-Strand Annealing Plays a Major Role in Double-Strand DNA Break Repair following CRISPR-Cas9 Cleavage in Leishmania
... involves direct ligation at the break site, often with small insertions or ...homologous direct repeat sequences (26 to 500 bp) flanking the DSB and extensive ...
26
Gene transfer in higher plants for the development of genetically modified crops (gm crops)
... Plant transformation using Ti-plasmid of Agrobacterium tumefaciens has become the most powerful method of foreign gene introduction into plant cells and subsequent regeneration of transgenic plants. The genetic ...
17
Plasmid recombination in a rad52 mutant of Saccharomyces cerevisiae.
... conversion tract length or frequency of associated reciprocal crossovers, (2) direct repeat recombination can follow a RAD52-independent pathway which pro- duces nonrecipro[r] ...
16
Molecular characterization of lengthy mitochondrial DNA duplications from the parasitic nematode Romanomermis culicivorax.
... All known duplications of animal mtDNA are pres- ent as intact tandem, direct repeat units except those in the nematode Romanomermis culicivorax, where in- verted copies [r] ...
10
Point mutations in the Moloney murine leukemia virus enhancer identify a lymphoid-specific viral core motif and 1,3-phorbol myristate acetate-inducible element.
... We have introduced point mutations into each of the known nuclear factor-binding sites in the MoMLV enhancer, in both copies of the direct repeat, and have analyzed the transcriptional a[r] ...
8
The influence of primary and secondary DNA structure in deletion and duplication between direct repeats in Escherichia coli.
... (3) Misalignment between the first direct repeat the progeny strand and the second direct repeat in the template strand is shown in which the palindromic region forms a perfe[r] ...
14
Study of Restriction Fragment Length Polymorphism Analysis and Spoligotyping for Epidemiological Investigation ofMycobacterium bovis Infection
... the direct repeat sequence, and the polymorphic GC-rich sequence (PGRS) and a PCR-based typing method called spacer oligonucleotide typing (spoligotyping) were used to strain type Mycobacterium bovis ...
6
Genetic Diversity of Mycobacterium africanum Clinical Isolates Based on IS6110 Restriction Fragment Length Polymorphism Analysis, Spoligotyping, and Variable Number of Tandem DNA Repeats
... analysis, direct repeat-based spacer oligonucleotide typing (spoligotyping), variable number of tandem DNA repeats (VNTR), and the polymorphism of the oxyR, pncA, and mtp40 ...
9