modulation of gene expression
Modulation of gene expression in drug resistant Leishmania is associated with gene amplification, gene deletion and chromosome aneuploidy
... 2 Modulation of gene expression in Leishmania cells resistant to ...fold modulation either on a chromosome by chromosome basis (1 to 36) or as a scatter plot (inserts) for both (a) ...
16
Strategies for precision modulation of gene expression by epigenome editing: an overview
... Engineered improvements Several laboratories have begun to utilize the geneti- cally engineered Cas9 proteins and sgRNAs (Fig. 2). One alterative involves a versatile scaffolding platform to attach multiple VP64 domains ...
12
Epigenetic Modulation of Gene Expression from Quiescent Herpes Simplex Virus Genomes
... Real-time PCR. Reactions for ChIP or cDNA quantification were performed in triplicate using 5 l of DNA for each reaction as described previously (51), with a few modifications. Before the 96-well reaction plate was set ...
11
Modulation of gene expression in subjects at risk for colorectal cancer by the chemopreventive dithiolethione oltipraz
... the expression of detoxication enzymes in various tissues, and its protective activity against the formation of chemically induced col- orectal tumors in ...detoxicating gene expression in human ...
9
Modulation of gene expression in a human cell line caused by poliovirus, vaccinia virus and interferon
... Most of the previously published microarray reports used either clinical material or in vitro cell cultures that were not synchronously infected. Moreover, the arrays typically detected only subsets of the human ...
9
Modulation of gene expression in endothelial cells by hyperlipaemic postprandial serum from healthy volunteers
... changes in migration or endothelial/monocyte interactions were observed. The transcriptomic analysis revealed changes in the expression of 675 genes, of which 431 have a known function. Among them, a set of ...
12
Increased gene expression for VEGF and the VEGF receptors KDR/Flk and Flt in lungs exposed to acute or to chronic hypoxia Modulation of gene expression by nitric oxide
... R M Tuder, … , B E Flook, N F Voelkel J Clin Invest. 1995;95(4):1798-1807. https://doi.org/10.1172/JCI117858. Endothelial cells constitute an essential integrator of factors that effect blood vessel remodeling induced by ...
11
DNA Binding and Modulation of Gene Expression by the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus
... By gene expression profiling, we have shown that LANA can positively or negatively modulate transcription of viral and cellular genes ...LANA expression vector pcDNA3/LANA into 293 ...
11
PKCλ regulates glucose induced insulin secretion through modulation of gene expression in pancreatic β cells
... the expression of genes regulated by HNF3b was also affected (that of Sur1 and ...HNF3b expression by infection of islets from bPKCl –/– mice with an adenoviral vector significantly reversed the defect in ...
9
The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease protective antigenic challenge
... the gene expression profiles of arthritic LEW rats at different phases of the disease as well as the modulation of gene expression by a tolero- genic disease-protective regimen ...
16
Modulation of fibronectin gene expression in human mononuclear phagocytes
... polysaccharide (LPS) or immune complexes, fibronectin mRNA levels decreased and in parallel, the cells secreted less fibronectin; (d) in idiopathic pulmonary fibrosis (IPF), alveo- lar m[r] ...
9
Posttranscriptional modulation of bacteriophage P22 scaffolding protein gene expression.
... gene 5 mRNA increased in functional stability with time after infection, then the coat protein should have been made at higher rate, relative to the other late proteins, at late times.. [r] ...
7
Complex modulation of androgen responsive gene expression by methoxyacetic acid
... Methods: A mouse TM3 Leydig cell line that stably expresses androgen receptor (TM3-AR) was prepared and analyzed by transcriptional profiling to identify target gene interactions between MAA and testosterone on a ...
14
Assembly-controlled autogenous modulation of bacteriophage P22 scaffolding protein gene expression.
... The experiments presented here show that (i) the amount of unassembled scaffolding protein in wild-type P22-infected cells at various times after infection or in various P22 mutant-infec[r] ...
6
Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
... of gene ex- pression in epithelial cells was dependent on Y 481 of the SH2-B motif of ...induce expression of K15- downstream targets Dscr1 and Cox-2 and NFAT activity, indi- cating host-cell-dependent ...
17
The modulation of Nicotiana benthamiana gene expression by Red clover necrotic mosaic virus
... debneyi and N. suaveolens. N. benthamiana is an amphiploid species, n=19, with a genome size estimated between 3.2 to 3.8 Gbp (uncited). N. benthamiana is often used as a model host for numerous fungal and bacterial ...
87
Zebrafish zic2a patterns the forebrain through modulation of Hedgehog activated gene expression
... own expression domain, probably through limiting Hh ...Hh-activated gene expression in the developing forebrain and advance our understanding of a key gene regulatory network that, when ...
10
Modulation of Murine Intestinal Gene Expression by Dietary Fat: Spatial Variation and Saturation Effect
... linear gene expression represents a constant raise in response to increasing fat ...enhanced gene expression behavior as a consequence of highest levels of fat ...either gene-specific ...
132
Influence of genotype on the modulation of gene and protein expression by n-3 LC-PUFA in rats
... forward GGGAAATCGTGCGTGACATT (20 bp) and reverse GCGGCAGTGGCCATCTC (17 bp). Amplicon length was 76 bp on the recognized sequence NM_031144. Glyceraldehyde-3-phosphate-dehydrogenase (Gapdh) and b-actin were chosen as ...
12
Modulation of Circadian Gene Expression and Metabolic Compensation by the RCO-1 Corepressor of Neurospora crassa
... The importance of nutritional parameters as environmen- tal cues that can regulate circadian period and expression has been described in different organisms (Kohsaka et al. 2007; Nakahata et al. 2008; Xu et al. ...
26