[PDF] Top 20 Mapping human development at single cell resolution
Has 10000 "Mapping human development at single cell resolution" found on our website. Below are the top 20 most common "Mapping human development at single cell resolution".
Mapping human development at single cell resolution
... Understanding human development is a fundamental quest that involves diverse areas of basic biology ranging from regulation of gene expression and epigenetics, cellular decision-making and differentiation ... See full document
5
High-resolution mapping of the human T-cell leukemia virus type 1 Rex-binding element by in vitro selection.
... As a specific example, a chemically synthesized template for bulge-right (9.3 mM final concentration; 59 GGGCAATTGCTCAGGAAGAGCATGCTCCCT TGGAGCAATTGAATT 39) and its primer (94 mM final concentration; 59 AAT TCAATTGCTCCAAG ... See full document
11
Development of Broadly Neutralizing Antibodies and Their Mapping by Monomeric gp120 in Human Immunodeficiency Virus Type 1-Infected Humans and Simian-Human Immunodeficiency Virus SHIVSF162P3N-Infected Macaques
... The GB40 MAbs recovered from dual staining of gp120 W479A ⫹ D368R ⫹ B cells showed only tier 1 (GB40_b1 to GB40_b9) or no (GB40_b10 to GB40_b13) neutralizing activity, indicating that this dual staining with gp120s was ... See full document
15
Genome wide mapping of promoter anchored interactions with close to single enhancer resolution
... kb resolution prevents mapping of individual promoter – en- hancer interactions [13], and improvement in resolution scales with the square of the sequence ...higher resolution than Hi-C, the ... See full document
13
RRHP: a tag based approach for 5 hydroxymethylcytosine mapping at single site resolution
... from human male cerebellum or tumor and adjacent normal tissue was purified via phenol: chloroform extraction and digested for 8 h at 37°C with 20 U MspI ... See full document
13
Systematic quantification of developmental phenotypes at single cell resolution during embryogenesis
... of cell positions over 53 wild- type ...of cell positions over the same set of wild-type embryos as in late ...C cell and non-C periphery cell groups in each ...C cell movement to the ... See full document
9
Mapping nonlinear receptive field structure in primate retina at single cone resolution
... to Y cells. In contrast, the parvocellular-projecting midget RGCs have usually been likened to linear X cells (Shapley et al., 1981; Kaplan and Shapley, 1982; Derrington and Lennie, 1984; Levitt et al., 2001). The ... See full document
21
The single-cell sequencing: new developments and medical applications
... the single-cell level. Vitak et al. [3] proposed a single-cell combinatorial marker sequencing technique (SCI-seq) that can simultaneously construct thousands of single- cell ... See full document
9
Quantitative semi automated analysis of morphogenesis with single cell resolution in complex embryos
... Among the many possible segmentation methods for finding nuclear positions, such as active contours or gradient flow (Dufour et al., 2005; Li et al., 2007), we found that the maximum of the convolution of raw data with a ... See full document
9
Silk nanoparticles : proof of lysosomotropic anticancer drug delivery at single cell resolution
... To date, attempts to characterise lysosomotropic drug release from silk nanoparticles have been conducted by measuring drug release from silk nanoparticles in buffer solutions that mimic the pH of the lysosome (pH 4.5 – ... See full document
8
Identification of cardiovascular lineage descendants at single cell resolution
... for cell-based therapy and as in vitro platforms for disease pathway and therapeutic drug discovery, their phenotype has been recognized as largely immature (Feinberg et ...our single-cell multiplex ... See full document
12
Relation of Cumulus Cell Status with Single Oocyte Maturity, Fertilization Capability and Patient Age
... cumulus cell apoptosis (2, 4, 6, 11−17) or their transcriptomic profile ...of human cumulus cell density in single complexes, and its relationship with important oocyte and embryo ...continual ... See full document
7
Single cell transcriptomics : a high resolution avenue for plant functional genomics
... and cell ploidy increases with cell development ...increasing cell and genome stability ...stem cell niche once these start to differentiate [28]. Cell type-specific microarray ... See full document
12
Multivariate patterning of human pluripotent cells under perfusion reveals critical roles of induced paracrine factors in kidney organoid development
... including single-cell polymerase chain reaction (9, 10), on-chip in situ sensing (11–13), cell coculture (14), and subcellular isolation ...a single device ...and development (17, ... See full document
14
PASTMUS: mapping functional elements at single amino acid resolution in human cells
... Since each amino acid has 19 kinds of non-synonymous substitutions, we hypothesized that different substitu- tions might have distinct effects. We retrieved missense mutation data of top hits from PSMB5 and PLK1 and ... See full document
16
Single-Nucleotide Resolution Mapping of Hepatitis B Virus Promoters in Infected Human Livers and Hepatocellular Carcinoma
... in human tissues has not been described so far using conventional technologies, due to the compact structure of the HBV genome and the overlap of different open reading ... See full document
12
Mapping chromatin modifications at the single cell level
... and mapping DNA modifications at the single cell ...for mapping 5mC/5hmC with single nucleotide ...involves cell preparation, DNA adapter ligation, bisulfite conversion, PCR ... See full document
16
Mapping human pluripotent stem cell differentiation pathways using high throughput single cell RNA sequencing
... the single-cell gene expression dynamics of each progenitor cell, so we constructed differentiation trajec- tory for each cell type with day 8 EBs ...of development and ...progenitor ... See full document
19
Localization and abundance analysis of human lncRNAs at single cell and single molecule resolution
... visualize single lncRNA molecules directly inside of cells, we used an established protocol for single molecule RNA FISH [24], where we design 10 to 48 complementary DNA oligonucleotides, each 20 bases long ... See full document
16
Single cell resolution of morphological changes in hemogenic endothelium
... In order to study the developmental stages that span hematopoietic emergence, we expanded our evaluation to the murine system. We first investigated hemogenic endothelial sites prior to the appearance of intra-aortic ... See full document
6
Related subjects