[PDF] Top 20 Sequence Requirements for Removal of tRNA by an Isolated Human Immunodeficiency Virus Type 1 RNase H Domain
Has 10000 "Sequence Requirements for Removal of tRNA by an Isolated Human Immunodeficiency Virus Type 1 RNase H Domain" found on our website. Below are the top 20 most common "Sequence Requirements for Removal of tRNA by an Isolated Human Immunodeficiency Virus Type 1 RNase H Domain".
Sequence Requirements for Removal of tRNA by an Isolated Human Immunodeficiency Virus Type 1 RNase H Domain
... the tRNA alter the recognition of both the isolated RNase H domain and the full-length HIV-1 ...HIV-1 isolated RNase H ...the tRNA primer were ... See full document
8
Comparison of Second-Strand Transfer Requirements and RNase H Cleavages Catalyzed by Human Immunodeficiency Virus Type 1 Reverse Transcriptase (RT) and E478Q RT
... the tRNA, a polymerase-dependent binding mode and a polymerase-independent binding ...exonuclease RNase H activities were previously described ...the RNase H active site within the U5 ... See full document
12
Revealing Domain Structure through Linker-Scanning Analysis of the Murine Leukemia Virus (MuLV) RNase H and MuLV and Human Immunodeficiency Virus Type 1 Integrase Proteins
... viable domain mapped onto the HIV-1 core-C terminus structure ...IN sequence IATDIQFKELQKQI (44), which is highlighted in red (A204 to I217 of the A molecule in 1EX4 is taken from the ... See full document
14
Virion Instability of Human Immunodeficiency Virus Type 1 Reverse Transcriptase (RT) Mutated in the Protease Cleavage Site between RT p51 and the RT RNase H Domain
... leukemia virus consists of a single subunit (29), suggesting that the cat- alytically active enzyme is a monomer or perhaps ...leukemia virus RT have a single subunit com- position and possess substantial ... See full document
10
Mutations in Human Immunodeficiency Virus Type 1 RNase H Primer Grip Enhance 3′-Azido-3′-Deoxythymidine Resistance
... the virus to increase the efficiency of nucleotide excision and continue reverse tran- scription, thus escaping the effects of nucleoside RT inhibitors (NRTIs) ...reduce RNase H activity increase ... See full document
9
Contributions of DNA polymerase subdomains to the RNase H activity of human immunodeficiency virus type 1 reverse transcriptase.
... 5721 Downloaded from http://jvi.asm.org/ on November 9, 2019 by guest Previous studies showed that an isolated human immunodeficiency virus type 1 HIV-1 RNase H domain expressed as a fus[r] ... See full document
9
Effects of modifying the tRNA(3Lys) anticodon on the initiation of human immunodeficiency virus type 1 reverse transcription.
... Quantitative determination of genomic RNA in an HIV-1 viral RNA sample. Antisense primer A55 (5 9 CTGCTAGAGATTTTCCACACTGAC3 9 ) was used for primer extension to quantitate the genomic RNA (4). This primer binds to ... See full document
7
Effects of Mutations in the G Tract of the Human Immunodeficiency Virus Type 1 Polypurine Tract on Virus Replication and RNase H Cleavage
... the RNase H cleavages to occur with ...the RNase H cleavage reactions that generate and remove the PPT (18, 24, 25, 28, ...of RNase H cleavage in vitro; however, the data are ... See full document
10
RNase H Requirements for the Second Strand Transfer Reaction of Human Immunodeficiency Virus Type 1 Reverse Transcription
... lanes 1 to 4). However, a low level of RNase H cleavage product (33-mer; ...by RNase H when HIV-1 RT was ...the tRNA would result in a 116-mer labeled DNA ... See full document
9
Subunit-specific mutagenesis of the cysteine 280 residue of the reverse transcriptase of human immunodeficiency virus type 1: effects on sensitivity to a specific inhibitor of the RNase H activity.
... the RNase H domain of p66 (9, ...acid sequence, X-ray crystallographic analysis has shown that they play different structural roles in the HIV-1 RT heterodimer (1, 16, 18, 24, ... See full document
5
RNase H Cleavage of the 5′ End of the Human Immunodeficiency Virus Type 1 Genome
... the RNase H of HIV-1 ...of RNase H itself and the RNase H primer grip contacts 11 base pairs (from the phos- phate between positions ⫺ 9 and ⫺ 8 from the cleavage site or ... See full document
7
Biochemical and Structural Analysis of Isolated Mature Cores of Human Immunodeficiency Virus Type 1
... stained isolated HIV-1 cores re- vealed that they were not collapsed but exhibited a defined three-dimensional ...resembling isolated cores from HIV-2, SIV, and EIAV (5, 27, 42, ... See full document
10
Analysis of Natural Sequence Variation and Covariation in Human Immunodeficiency Virus Type 1 Integrase
... Subtype-dependent sequence variation was observed in all three structural domains of HIV-1 ...N-terminal domain showed the greatest variation on the side of the bundle that interacts with the ... See full document
8
Identification of the principal neutralizing determinant of human immunodeficiency virus type 1 as a fusion domain.
... Our observation that a conservative mutation at a nonconserved residue of the V3 loop amino acid 325 significantly reduced syncytium formation suggests that the nonconserved regions loca[r] ... See full document
5
Comparative Study of Methods for Detecting Sequence Compartmentalization in Human Immunodeficiency Virus Type 1
... the virus from CCR5 to CRCX4 receptors can confer a selec- tive ...sequences isolated from different com- partments within the same patient, focusing on sequences de- rived from the CNS and the female ... See full document
9
Identification of a Key Target Sequence To Block Human Immunodeficiency Virus Type 1 Replication within thegag-pol Transframe Domain
... Another possible antiviral target pursued over the years is the HIV-1 genome itself. Antisense reagents, in particular, have been extensively investigated primarily in the form of nuclease-resistant ... See full document
13
Autologous antibody response against the principal neutralizing domain of human immunodeficiency virus type 1 isolated from infected humans.
... 1612 Downloaded from http://jvi.asm.org/ on November 9, 2019 by guest High titers of neutralizing antibodies in human immunodeficiency virus type 1 HIV-1 infection are directed primarily[r] ... See full document
8
Selection of Mutations in the Connection and RNase H Domains of Human Immunodeficiency Virus Type 1 Reverse Transcriptase That Increase Resistance to 3′-Azido-3′-Dideoxythymidine
... merase domain of HIV-1 ...and RNase H domains of ...RT RNase H activity, also increase resistance to AZT ...the RNase H domain that decrease RNase ... See full document
8
Construction of a type 1 human immunodeficiency virus that maintains a primer binding site complementary to tRNA(His).
... HIV-1 genome affected viral gene expression, we analyzed COS-1 cells transfected with the mutant and wild-type proviral genomes for intracellular viral proteins and the supernatants for released ... See full document
10
Characterization of the Outer Domain of the gp120 Glycoprotein from Human Immunodeficiency Virus Type 1
... tralizing human serum preparations, some of the antibodies elicited by these soluble trimers may be directed against epitopes not well represented on the virion-associated en- velope ... See full document
12
Related subjects