• No results found

[PDF] Top 20 Sequences in the 5′ and 3′ R Elements of Human Immunodeficiency Virus Type 1 Critical for Efficient Reverse Transcription

Has 10000 "Sequences in the 5′ and 3′ R Elements of Human Immunodeficiency Virus Type 1 Critical for Efficient Reverse Transcription" found on our website. Below are the top 20 most common "Sequences in the 5′ and 3′ R Elements of Human Immunodeficiency Virus Type 1 Critical for Efficient Reverse Transcription".

Sequences in the 5′ and 3′ R Elements of Human Immunodeficiency Virus Type 1 Critical for Efficient Reverse Transcription

Sequences in the 5′ and 3′ R Elements of Human Immunodeficiency Virus Type 1 Critical for Efficient Reverse Transcription

... of reverse transcription (Fig. 1C). As previously reported, a virus containing the mS-1 mutation in only the 5⬘ copy of TAR accumulated markedly reduced amounts of all the products of ... See full document

11

Nucleotide substitutions within U5 are critical for efficient reverse transcription of human immunodeficiency virus type 1 with a primer binding site complementary to tRNA(His).

Nucleotide substitutions within U5 are critical for efficient reverse transcription of human immunodeficiency virus type 1 with a primer binding site complementary to tRNA(His).

... this virus, which contained the G-to-A mutation, repli- cated similarly to the virus derived from pHXB2(His-AC- GAC) ...U5-PBS sequences from these viruses with the wild-type RT revealed ... See full document

8

Vpx Is Critical for Reverse Transcription of the Human Immunodeficiency Virus Type 2 Genome in Macrophages

Vpx Is Critical for Reverse Transcription of the Human Immunodeficiency Virus Type 2 Genome in Macrophages

... in human MDMs by using HSC-F cells (3, 4) as a cell control ...of human MDMs by virus samples from 293T cells (17) transfected with proviral clones was very much inefficient and gave ambiguous ... See full document

5

Mutations in Human Immunodeficiency Virus Type 1 Nucleocapsid Protein Zinc Fingers Cause Premature Reverse Transcription

Mutations in Human Immunodeficiency Virus Type 1 Nucleocapsid Protein Zinc Fingers Cause Premature Reverse Transcription

... which reverse transcription can occur in extracellular virus ...⬃ 5 ⫻ 10 ⫺19 ...cell type but are typically 3 to 5 ␮ M ...as efficient as the premature ... See full document

11

Human Immunodeficiency Virus Type 1 Integrase Protein Promotes Reverse Transcription through Specific Interactions with the Nucleoprotein Reverse Transcription Complex

Human Immunodeficiency Virus Type 1 Integrase Protein Promotes Reverse Transcription through Specific Interactions with the Nucleoprotein Reverse Transcription Complex

... Reverse transcription is catalyzed by RT, and although re- verse transcription can occur in vitro with recombinant RT, template, and primer, the process is more complex in ...replicating ... See full document

10

Cell Factors Stimulate Human Immunodeficiency Virus Type 1 Reverse Transcription In Vitro

Cell Factors Stimulate Human Immunodeficiency Virus Type 1 Reverse Transcription In Vitro

... and reverse tran- scription products were detected in the ...strong-stop reverse transcription products was detected (peak R in ...strand transcription products was greatly increased by ... See full document

13

Contribution of the C terminal tri lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import

Contribution of the C terminal tri lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import

... including 5'-Alu oligo (5'- TCCCAGCTACTCGGGAGGCTGAGG-3') and 3'-LTR oligo (5'-AGGCAAGCTTTATTGAGGGCTTAAGC-3') (nt position 9194) located respectively in the conserved region of ... See full document

15

Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell.

Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell.

... Nef 1 and Nef 2 isogenic human immunodeficiency virus in CEM, HUT78, MT4 lymphoid, and U937 monocytic cell ...the virus particles released in culture media by measuring the number of ... See full document

7

Effects of modifying the tRNA(3Lys) anticodon on the initiation of human immunodeficiency virus type 1 reverse transcription.

Effects of modifying the tRNA(3Lys) anticodon on the initiation of human immunodeficiency virus type 1 reverse transcription.

... Quantitative determination of genomic RNA in an HIV-1 viral RNA sample. Antisense primer A55 (5 9 CTGCTAGAGATTTTCCACACTGAC3 9 ) was used for primer extension to quantitate the genomic RNA (4). This primer ... See full document

7

Association of Human Immunodeficiency Virus Type 1 Vif with RNA and Its Role in Reverse Transcription

Association of Human Immunodeficiency Virus Type 1 Vif with RNA and Its Role in Reverse Transcription

... a 5-min extension at ...and 5⬘-CTGCTAGAGA TTTTCCACACTGAC-3⬘, respectively), R (5⬘-GGCTAACTAGGGAACCCAC TGCTT-3⬘) and U5, and TAR (5⬘-GGTCTCTCTGGTTAGACCAGATCT-3⬘) and ... See full document

8

Intracytoplasmic maturation of the human immunodeficiency virus type 1 reverse transcription complexes determines their capacity to integrate into chromatin

Intracytoplasmic maturation of the human immunodeficiency virus type 1 reverse transcription complexes determines their capacity to integrate into chromatin

... which reverse transcription was artificially ...block reverse transcrip- tion. Cytoplasmic and nuclear HIV-1 complexes were iso- lated from AZT-treated and untreated cell extracts 5 h ... See full document

12

Exon 1 leader sequences downstream of U5 are important for efficient human immunodeficiency virus type 1 gene expression.

Exon 1 leader sequences downstream of U5 are important for efficient human immunodeficiency virus type 1 gene expression.

... exon 1 portion of the lsdU5 element have been reported to contain binding sites for the nuclear factors DBF1 and Sp1 and to be important for basal HIV-1 promoter activity ...reduce transcription and ... See full document

8

Inhibitors of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Target Distinct Phases of Early Reverse Transcription

Inhibitors of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Target Distinct Phases of Early Reverse Transcription

... and 3⬘-flanking RNA sequences, U5 (21, 23), and the TAR RNA element (6, ...that reverse transcription elongation appears to be induced under conditions that favor the completion of pro- viral ... See full document

10

The Role of Nucleocapsid and U5 Stem/A-Rich Loop Sequences  in tRNA3Lys Genomic Placement and Initiation of Reverse Transcription in Human Immunodeficiency Virus Type 1

The Role of Nucleocapsid and U5 Stem/A-Rich Loop Sequences in tRNA3Lys Genomic Placement and Initiation of Reverse Transcription in Human Immunodeficiency Virus Type 1

... Lane 1, HIV-1 (BH10) proviral DNA in an HpaI-linearized plasmid DNA ...lane 3, molecular weights of the RNA size markers; lane 5, undigested RNA probe; lane 6, yeast RNA; lanes 7 to 11, ... See full document

9

Role of Vif in human immunodeficiency virus type 1 reverse transcription.

Role of Vif in human immunodeficiency virus type 1 reverse transcription.

... stimulate reverse transcription or preceding early postentry ...(Fig. 5 and 6) and previous studies suggest that Vif does not affect viral RNA encapsida- tion (3, 40), dimerization, or the ... See full document

9

A critical role for the TAR element in promoting efficient human immunodeficiency virus type 1 reverse transcription.

A critical role for the TAR element in promoting efficient human immunodeficiency virus type 1 reverse transcription.

... wild-type virus at 2 h, and the amount of this species increased fivefold at 24 h postin- fection ...wild- type virus for the TAR stem disruption mutants 1 15/ 1 17 ...17), ... See full document

11

Identification of sequences downstream of the primer binding site that are important for efficient replication of human immunodeficiency virus type 1.

Identification of sequences downstream of the primer binding site that are important for efficient replication of human immunodeficiency virus type 1.

... Reverse transcription of retroviruses is initiated from an 18-nucleotide (nt) primer binding site (PBS), located within the 5 * region of viral genomic RNA, to which the host cell-derived tRNA primer ... See full document

8

Genetic Dissociation of the Encapsidation and Reverse Transcription Functions in the 5′ R Region of Human Immunodeficiency Virus Type 1

Genetic Dissociation of the Encapsidation and Reverse Transcription Functions in the 5′ R Region of Human Immunodeficiency Virus Type 1

... the reverse transcriptase moiety of the Gag-Pol polypro- tein, not through hybridization with the primer binding site ...for efficient proviral DNA ...for efficient reverse transcrip- tion ... See full document

9

Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription

Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription

... ment reverse transcription defects associated with HIV-1 Dtat ...HIV-1 transcription, were unable to complement the reverse transcription defect in HIV-1 Dtat ... See full document

10

Human Immunodeficiency Virus Type 1 (HIV-1) Viral Protein R (Vpr) Interacts with Lys-tRNA Synthetase: Implications for Priming of HIV-1 Reverse Transcription

Human Immunodeficiency Virus Type 1 (HIV-1) Viral Protein R (Vpr) Interacts with Lys-tRNA Synthetase: Implications for Priming of HIV-1 Reverse Transcription

... Plasmid construction. pV44ER.LexA and pACT/pACT-cDNA were received from Colin Goding (Marie Curie Research Institute, Oxted, United Kingdom) and Stephen Elledge (Baylor College of Medicine, Houston, Tex.), respectively, ... See full document

8

Show all 10000 documents...