single nucleotide polymorphism

Rheumatoid arthritis (RA) is a chronic disease with known autoimmune pathophysiology. RA is a heritable condition and association studies have already identified a genomic region in chromosome 6 (the HLA region). While this represents progress in elucidating genetic contributions to RA, much is still unknown about the underlying genetic causes, and there is plenty of evidence that there exist other genes affecting disease risk, both as major effects and in epistasis [1]. Genome-wide associa- tion studies (GWAS) of diseases and complex traits have become a major focus of research in human genetics. GWAS may provide robust results for acquiring knowl- edge on the underlying genetic behavior of RA. One of the most difficult challenges of GWAS is how to deal with the large p , small n problem, arising when the number of variables considered ( p ) is much larger than the number of subjects (n). The problem becomes particularly difficult when one seeks to estimate single- nucleotide polymorphism (SNP) by SNP interactions. One approach for efficiently handling high dimensional GWA data consists of two steps: 1) reducing dimension- ality by filtering non-informative markers, and 2) applying a more sophisticated model to quantify the effect of the selected SNPs and their interactions. Information gain and the wrapper procedure are exam- ples of machine learning that have shown benefits over linear regression for Step 1. These methods are easy to implement and may deal with crude, noisy, and inconsistent information. They alleviate redundancy, colinearity, and the assumption of multivariate normal- ity, making them appealing in genomic studies. The function that relates covariates to observations is unspecified, providing more flexibility in the model. Further, they may deal with non-additive effects, which are of interest in genetic epidemiology. Some drawbacks to these methods exist: information gain may not completely remove colinearity in the system and the wrapper procedure it is too computationally demanding to use on a large number of records and SNPs. Hence, a second step is necessary. A large variety of methods have been previously proposed for Step 2. Here, we propose a novel method that is able to reduce colinearity and make a higher shrinkage to zero than other methods for less relevant SNP and SNP × SNP effects.

The genotyping of genetic variations of single nucleotide polymorphism (SNP) T45G and SNP G276T adiponectin gene was performed by allele polymerase chain reaction (PCR) amplification method from deoxyribonucleic acid (DNA) genome. DNA is extracted from blood containing ethylenediaminetriacetic acid. The PCR reaction consisted of amplification of 100 ng template DNA up to a 25 µL volume through denaturation at 950C for 5 min, followed by 35 cycles (950C for 45 s, 550C for 45 s, and 720C for 1 min and extension at 720C for 2 min) [5]. The genetic variation of SNP T45G adiponectin gene using the forward primer 5’GAAGTAGACTCTGCTGAGATGG 3’ and reverse primer 5’TATCAGTGTAGGAGGTCTGTGATG 3’ with the cutting enzyme of SmaI (NEB) and the cuts were then electrophoretically separated on 2% agarose gel.

Systemic lupus erythematosus (SLE ) is a typical autoimmune disease characterized by abnormal immunologic response.T lymphocyte and B lymphocyte activation results in production of multifarious autoantibodies with several tissue damage.Lupus nephritis (LN) is the most common and lethal manifestation of SLE. Lupus nephritis is frequently associated with abnormal production of cytokines. OPN induces B lymphocyte to produce polyclonal antibodies 144 . OPN carry out a variety of functions in the body which includes early T lymphocyte activation that’s why it is called as early T lymphocyte activation 1 (Eta- 1), increases T-helper 1 cell population and decreases T-helper 2 cells and thus contribute to cell-mediated immunologic response 145,146 .Several studies have found that OPN is an essential component in the autoimmune mediated pathogenesis of SLE 147,148 .There is a promising association of OPN gene polymorphism with systemic lupus erythematosus. A single nucleotide polymorphism (SNP) at position 9250 with replacement of C by T in exon 7 of the OPN gene (OPN gene 9250) is newly detected in humans 149 .

Mu-opioid receptors (MOPR) are integrally involved in the modulation of several pathways including pain and drug reward. Genetic mutations of the MOPR alter endogenous and exogenous opioidergic function, thus influencing behavior. A single nucleotide polymorphism (SNP) in exon 1 of the µ-opioid receptor gene (OPRM1), in which an adenine to guanine substitution (A118G) exchanges an asparagine for an aspartic acid at a putative N-glycosylation site (N40D), has been associated with an altered vulnerability to opioid addiction (Ray and Hutchison, 2004; Drakenberg et al., 2006; van den Wildenberg et al., 2007), a decreased response to opioid-induced analgesia (Chou et al., 2006a; Sia et al., 2008), and an enhanced response to therapies for alcohol (Ray and Hutchison, 2007; Anton et al., 2008) and nicotine addiction (Lerman et al., 2004). In vitro studies using a variety of cell lines expressing the G118 allele have reported increased affinity of the receptor to the endogenous opioid !-endorphin (Bond et al., 1998) and elevated ability of exogenous opioids to inhibit calcium currents (Margas et al., 2007); however, these results were dependent on the cell type and transfection method utilized and other studies have reported no differences in agonist binding, functional coupling, or desensitization (Befort et al., 2001; Beyer et al., 2004). Conversely, studies have reported decreases in MOPR mRNA (Zhang et al., 2005) and cell surface expression of the receptor (Beyer et al., 2004; Zhang et al., 2005; Kroslak et al., 2007), suggesting a loss of receptor function.

In recent years, with the development of bioinformatics and molecular detection technology, the research of single nucleotide polymorphism (SNP) has attracted much attention all over the world [1]. Generally speaking, SNP refers to a DNA sequence polymorphism caused by single-nucleotide variation at the genome level. For a single individual, SNP refers to polymorphic sites in the genome. For the population, SNP can be regarded as the base position with polymorphism in the population [2]. As a genetic variation, SNP can describe the vast majority of differences between individuals and groups of organisms [3]. Therefore, the SNP detection has been widely used in genomic research.

Arsenite methyltransferase )AS3MT( is one of the key enzymes involved in the transfer of a methyl group from S-adenosyl-L-methionine to trivalent arsenical and play a critical role in arsenic detoxification. As2O3 polymorphism at position 287 (Met287Thr) critically influences arsenic metabolism. The frequencies of Met287Thr, T>C (rs11191439) AS3MT gene have been studied in other ethnic groups of East Asia include: Chinese, Japanese, Korean, 9 Bangladesh 8 , South Americans, 10 also Caucasian and African Americans but no data are available for Iranian population. The aim of this study was to determine the frequency of the single nucleotide polymorphism M287T (rs11191439) in exon 9 of the AS3MT in Iranians and to assess the difference in allele frequencies with other ethnicities.

In genetics, mutation and polymorphism have some differences. A mutation is defined as a permanent change in the nucleotide sequence, while a polymorphism is defined as a variant with a frequency above 1% [1]. Polymorphisms have many kinds, in which Single Nucleotide Polymorphism (SNP) is a kind of DNA polymor- phism caused by single nucleotide variation, including transition, transversion, deletion and inversion in a given and specified genetic loca- tion. SNPs are distributed widely in genome with large quantities. According to location, SNPs are divided to 5’ near gene, 5’ untrans- lated region (UTR), intron, coding sequence (CDS), splice site (donor and acceptor), 3’ UTR and 3’ near gene, in NCBI/SNP database. SNP may affect gene function or not. Some SNPs may have no function, such as some 5’

Introduction:CDKAL1 single-nucleotide polymorphism rs 9465871variant is a risk locus for Type 2 Diabetes (T2DM).The study evaluated the associations of CDKAL1- rs9465871 with glycosylated hemoglobin A1C Level (HbA1c), fasting insulin level, insulin resistance and metabolic syndrome among obese and non- obese Egyptian children. Materials and Methods: The study included 43 obese children and 40 normal weight children. Anthropometric body measurements, bio-specimen and biochemistry assays were done. Genotyping of rs9465871 (CDKAL1) was conducted.

Background: Schizophrenia is a severe mental disorder affecting .21 million people worldwide. Some genetic studies reported that single nucleotide polymorphism (SNP) involving variant rs1344706 from the ZNF804A gene in human beings is associated with the risk of schizo- phrenia in several populations. Similar results tend to conflict with other reports in literature, indicating that no true significant association exists between rs1344706 and schizophrenia. We seek to determine the level of association of this SNP with schizophrenia in the Asian population using more recent genome-wide association study (GWAS) datasets.

Many studies have investigated the association between single nucleotide polymorphism (SNP) rs6983267 and the risk of prostate cancer. However, results of these studies are inconsistent. Therefore, we summarised available data and performed a meta-analysis to determine this association. Relevant articles were identified by searching the PubMed, Web of Science and Embase database. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated using random effects model. We used dominant model (GG + TG vs TT), recessive model (GG vs TG + TT) and additive model (GG +TT vs TG) to determine the association between the rs6983267 polymorphism and risk of prostate cancer. Summary, 9 studies involving 8726 participants were included in this meta-analysis. Overall, though no association was observed between the rs6983267 polymorphism and risk of prostate cancer, subgroup analysis according to ethnicity showed a significant association between the rs6983267 polymorphism and risk of prostate cancer among white European men [recessive model: GG vs TG + TT, OR=1.21, (95% CI: 1.03, 1.42), P=0.02]. Our results indicate that the GG genotype of the rs6983267 polymorphism will increase individual susceptibility to prostate cancer in white European men.

A single-nucleotide polymorphism (SNP) locus rs16917496 (T > C) within the 3′-untranslated region (3′-UTR) of SET8 was associated with susceptibility in several malignancies including breast cancer. To further elucidate the prognostic relevance of this SNP in breast cancer, we conducted a clinical study as well as SET8 expression analysis in a cohort of 1,190 breast cancer patients. We demonstrated the expression levels of SET8 in TT genotype were higher than in CC genotypes, and high levels of SET8 were associated with poor survival. SET8 expression was significantly higher in breast tumor tissue than in paired adjacent normal tissue. In addition, survival analysis in 315 patients showed SNP rs16917496 was an independent prognostic factor of breast cancer outcome with TT genotype associated with poor survival compared with CC/CT genotypes. Thus, this SNP may serve as a genetic prognostic factor and a treatment target for breast cancer. Future studies are warranted.

Development and application of methods using linkage- disequilibrium (LD) for single-nucleotide polymorphism (SNP) selection has empowered genetic epidemiologic studies. Tagging SNP selection methods capitalize on the high levels of LD in much of the genome and aim to cap- ture all of the common variation. SNP redundancy can be reduced, allowing for improved information/coverage within the constraints of a fixed budget. Three classes of tagging SNP methods have the following aims: 1) corre- late each SNP of interest with a genotyped SNP (pairwise methods), 2) correlate each SNP of interest with a geno- typed SNP or a combination of genotyped SNPs (multi- marker methods), or 3) explain each haplotype of interest using a set of genotyped SNPs (haplotype-based meth- ods). Investigators commonly select tagging SNPs using data from public projects [1] or a subset of study partici- pants, then genotype only the SNP subset in the larger study population [2,3].

Table 2. Conservation and relative single nucleotide polymorphism (SNP) density in different types of functional regions. For each functional region, we report the odds ratio that a nucleotide in that region will be a variant by comparison with the rest of the genome (essentially, the relative SNP density) and standard error. The expected number is obtained using the validated SNP in the genome (4.9 M) and the total number of base pairs of the genome within a particular class of functional elements. A number less than 1 indicates a deficiency in SNP number. We also report the fold conservation (as defined previously 112 ) compared with the genome average.

This review first describes the theoretical basis for single nucleotide polymorphism (SNP) tagging and then evaluates freely available software for the selection of tag SNPs for genetic association studies. The review is motivated by the author’s experience as part of an active group of epidemiolo- gists and statisticians and, especially, because of a now almost five-year-old ongoing collaboration between his group at the University of Southern California and members of the Broad Institute (formerly the Whitehead Institute) at MIT and Harvard University. The author has been involved in developing and implementing methods for selecting tag SNPs in candidate gene studies. In these studies, he and his colleagues have relied upon their own ‘haplotype discovery’ panel, in which, at present, almost 3,000 SNPs over

The goal of this study was to identify single-locus and epistasis effects of SNP markers on anti-cyclic citrullinated peptide (anti-CCP) that is associated with rheumatoid arthritis, using the North American Rheumatoid Arthritis Consortium data. A square root transformation of the phenotypic values of anti-CCP with sex, smoking status, and a selected subset of 20 single-nucleotide polymorphism (SNP) markers in the model achieved residual normality (p > 0.05). Three single- locus effects of two SNPs were significant (p < 10 -4 ). The epistasis analysis tested five effects of each

AQ: Autism Spectrum Quotient; AS: Asperger syndrome; ASC: Autism Spectrum Conditions; CEU: European samples of Utah Residents with Northern and Western European Ancestry; CNS: central nervous system; DSM-IV: Diagnostic and statistical manual of mental disorders fourth edition; ICD-10: International classification of diseases; LD: linkage disequilibrium; MAF: minor allele frequency; NADH: nicotinamide adenine dinucleotide; SLC25A12: solute carrier family 25 (aspartate/glutamate carrier); SNP: single nucleotide polymorphism.

information. A Single-Nucleotide Polymorphism (SNP) is a DNA sequence variation occurring when a single nucleotide differs between individuals. These SNPs are potentially the best type of genetic marker in genetic screening application because of their abundance in the genome and their association with genes that affect adaptive traits and susceptibility to disease. This study compared sequences of genes in diploid genomic DNA extracted from 24 individuals of each of 16 Pinus species. The analysis targeted 10 genes in each species that covered a total of 2988 bp, and detected a total of 374 potential SNPs. The number of

The extent of linkage disequilibrium (LD) is an important factor in designing association mapping experiments. Unlike other plant species that have been analyzed so far for the extent of LD, cultivated potato (Solanum tuberosum L.), an outcrossing species, is a highly heterozygous autotetraploid. The favored genotypes of modern cultivars are maintained by vegetative propagation through tubers. As a first step in the LD analysis, we surveyed both coding and noncoding regions of 66 DNA fragments from 47 accessions for single nucleotide polymorphism (SNP). In the process, we combined information from the potato SNP database with experimental SNP detection. The total length of all analyzed fragments was .25 kb, and the number of screened sequence bases reached almost 1.4 million. Average nucleotide poly- morphism (u ¼ 11.5 3 10 3 ) and diversity (p ¼ 14.6 3 10 3 ) was high compared to the other plant species.

BMC Proceedings Proceedings Evaluation of single nucleotide polymorphism imputation using random forests Daniel F Schwarz, Silke Szymczak, Andreas Ziegler and Inke R K?nig* Address Institut f?r Medizi[.]

The pancreatic BSDL also known as carboxyl-ester lipase (CEL), is secreted into the digestive tract playing a role in cholesterol-esters and lipid-soluble vitamin-esters hydrolysis [35]. Human BSDL gDNA is about 10 kb located on chromosome 9q34.3, with a variable number of tandem repeats (VNTR) in the coding region of exon 11 (from 3 to 21 repeats depending on species and the individual). These VNTR are formed of 33-base pair nearly identical segments [26]. Mutations in VNTR of the BSDL gene cause maturity-onset diabetes of the young (or MODY-8) [36]. Two different single-base deletions, located in repeat 1 and repeat 4, were detected in two families with dominantly inherited diabetes and exocrine dysfunction. Both deletions lead to a frame shift and a premature stop codon, creating a new C-terminal end of the translated BSDL protein and to a misfolded protein responsible for the diabetic pathology [37]. A study performed in a cohort of patients showed the absence of relation between the numbers of VNTR and alcoholic or idiopatic chronic pancreatitis [38] and pancreatic cancer [39]. A recent paper by Fjeld et al. suggested that a crossover between BSDL gene and BSDL pseudogene causes chronic pancreatitis [40]. Finally, Reuss et al. found that the lipase is not differently transcribed in PDAC and normal tissue [41] although VNTR hold oncofetal glyco- epitopes recognized by the 16D10 and J28 monoclonal antibodies which are of potential interest in PDAC therapy [42, 43].