[PDF] Top 20 Development and Application of Real Time PCR Assay for Quantification of Mycobacterium ulcerans DNA
Has 10000 "Development and Application of Real Time PCR Assay for Quantification of Mycobacterium ulcerans DNA" found on our website. Below are the top 20 most common "Development and Application of Real Time PCR Assay for Quantification of Mycobacterium ulcerans DNA".
Development and Application of Real Time PCR Assay for Quantification of Mycobacterium ulcerans DNA
... by Mycobacterium ulcerans, is, after tuberculosis and leprosy, the third most common mycobacterial ...M. ulcerans is not exactly known, but since Buruli ulcer often occurs in focalized swampy areas, ... See full document
7
Novel Wide Range Quantitative Nested Real Time PCR Assay for Mycobacterium tuberculosis DNA: Clinical Application for Diagnosis of Tuberculous Meningitis
... WR-QNRT-PCR assay is based on its capacity for the accurate quantitative detection of ...tuberculosis DNA with a wide detection range. However, this assay technique does not have the ability ... See full document
10
Novel Technique of Quantitative Nested Real Time PCR Assay for Mycobacterium tuberculosis DNA
... and PCR assay for cerebrospinal fluid (CSF) samples, are unable to rapidly detect Mycobacterium tuberculosis with sufficient sensitivity in the acute phase of ...TaqMan PCR, we designed a ... See full document
11
Novel Multiplex Real Time PCR Diagnostic Assay for Identification and Differentiation of Mycobacterium tuberculosis, Mycobacterium canettii, and Mycobacterium tuberculosis Complex Strains
... study, DNA was supplied by Mario Vaneechoutte and had been characterized using techniques previously described (10, 36, ...41). DNA isolation and quantification. Genomic DNA from NTM and 2 ... See full document
7
Real time PCR assays for hepatitis B virus DNA quantification may require two different targets
... HBV DNA quantification, we developed a duplex real-time PCR assay using two pairs of primers and probes based on conserved sequences of the S and C regions of the HBV ...same ... See full document
9
Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA
... (sense) 5 ’ -GCCAAAATTCGCAGTCCC-3 ’ , 0.5 μ M pri- mer hbv460 (antisense) 5’-GATAGTCCAGAAGAAC- CAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the 5’ ... See full document
6
Development and Assessment of a Multiplex Real Time PCR Assay for Quantification of Human Immunodeficiency Virus Type 1 DNA
... 32). Quantification of HIV RNA in plasma has routinely been used for assessment of the efficacy of highly active antiretroviral therapy (HAART), and it provides a strong predictor of HIV-1 disease progression (27, ... See full document
6
Quantification of Leishmania infantum DNA by a Real Time PCR Assay with High Sensitivity
... kinetoplast DNA-based method. Piarroux et al. (24) detected Leishmania DNA by targeting a repeated genomic sequence, and this method reached a sensi- tivity of 1 parasite per reaction; this assay was ... See full document
7
Novel Wide Range Quantitative Nested Real Time PCR Assay for Mycobacterium tuberculosis DNA: Development and Methodology
... This suggests that indoctrination is particularly effective where it can exploit preexisting stereotypes and beliefs 12, leading to a “magnification effect.” Data: Modern-Day Geographica[r] ... See full document
6
Development of a TT Virus DNA Quantification System Using Real Time Detection PCR
... TTV DNA levels among HCV-infected patients and blood ...TTV DNA levels could be quantified for 54 of 63 ...TTV DNA level was considered to be below the detection range of this ...TTV DNA ... See full document
5
A novel real time PCR assay for specific detection and quantification of Mycobacterium avium subsp paratuberculosis in milk with the inherent possibility of differentiation between viable and dead cells
... 32.5% PCR-positive pre-milk samples in a farm with two cows shedding MAP [27], whereas others observed 33% PCR-positive main milk samples under similar circumstances ...for DNA isolation and ... See full document
8
Performance of the Cobas AmpliPrep/Cobas TaqMan Real Time PCR Assay for Hepatitis B Virus DNA Quantification
... HBV DNA levels in international units per milliliter), automated, and rapid, with minimal hands-on time ...HBV DNA, regardless of the HBV genotype or sequence polymor- ...HBV DNA assays based ... See full document
8
Development of a PCR assay for rapid diagnosis of Mycobacterium ulcerans infection
... M. ulcerans DNA would circumvent many of the problems concerning the specific diagnosis and detection of this ...M. ulcerans infection in which PCR amplification and sequencing of 16S rRNA was ... See full document
5
Development of a new ultra sensitive real time PCR assay (ultra sensitive RTQ PCR) for the quantification of HBV DNA
... new assay showed improved sensitivity of 22 and 8 IU/mL as 95% and 50% detection end-points, respectively, versus the 94 IU/mL (250 copies/mL) of the previously reported quantitative test ...the assay was ... See full document
6
Evaluation of a real time PCR assay for detection and quantification of bacterial DNA directly in blood of preterm neonates with suspected late onset sepsis
... turnaround time (TAT) because it usually requires 1 day of ...the development of a diagnostic test that detects pathogens that cause LOS in a rapid, sensitive, and spe- cific manner is highly warranted to ... See full document
10
A nested real time PCR assay for the quantification of Plasmodium falciparum DNA extracted from dried blood spots
... qPCR assay described herein with those from an in- dependent protocol [15] provides confidence that the nested qPCR assay described here generates results that may be directly comparable to other studies ... See full document
8
Multicenter Performance Evaluation of a New TaqMan PCR Assay for Monitoring Human Immunodeficiency Virus RNA Load
... The HPS-CTMHIV assay’s precision, as assessed by intra- and interassay reproducibility, is good and is comparable to that of the CAHIM assay. Further improvement is expected when the RNA extraction procedure, ... See full document
5
New Highly Sensitive Real Time PCR Assay for HIV 2 Group A and Group B DNA Quantification
... This assay also displayed good linearity (6 to 6,000 copies/PCR) and within-run ...this assay that includes an external standard for quantification will improve the reliability of and the comparisons ... See full document
8
Multiplex Real Time PCR Assay for Simultaneous Quantification of BK Polyomavirus, JC Polyomavirus, and Adenovirus DNA
... Recently, real-time PCR methods have been introduced into clinical virology for the quantitative detection of viral copy numbers, and the exact determination of virus genome copy numbers provides ... See full document
6
Validation of a pan orthopox real time PCR assay for the detection and quantification of viral genomes from nonhuman primate blood
... Day; DNA: Deoxyribonucleic acid; FDA: ...primate; PCR: Polymerase chain reaction; PEC: Positive extraction control; PTS: Positive test sample; QARCO: Quality Assurance and Regulatory Compliance Office; SD: ... See full document
9
Related subjects