Herpes simplex virus type 1 recombination: the Uc-DR1 region is required for high-level a-sequence-mediated recombination.

0022-538X/94/$04.00+0

Copyright (C 1994,American Society for Microbiology

Herpes

Simplex Virus Type 1

Recombination: the

UC-DRI

Region Is Required for High-Level

a-Sequence-Mediated Recombination

REBECCA ELLISDUTCH, BORIS V. ZEMELMAN, ANDI. R. LEHMAN* Department of Biochemistry, Stanford University School of Medicine, Stanford, Califomia 94305

Received 21 December 1993/Accepted 2 March 1994

The a sequences of herpes simplex virus type 1 are believed to be the cis sites for inversion events that generatefourisomericforms of the viral genome. Using an assay that measures deletion of a ,-galactosidase genepositioned between twodirectlyrepeated sequences in plasmidstransientlymaintained in Vero cells, we hadfoundthat the a sequence is morerecombinogenicthan another sequence of similar size. To investigate the basis for theenhanced recombination mediated by the a sequence, we examined plasmids containing direct repeats ofapproximately 350 bp from avarietyofsources and with a wide range of G+C content. We observed that all of these plasmids show similar recombination frequencies (3 to 4%) in herpes simplex virus type 1-infected cells. However, recombination between directly repeated a sequences occurs at twice this frequency (6 to 10%).In addition,we find that insertion of acleavagesite for ana-sequence-specificendonuclease into the repeated sequences does not appreciably increase the frequency ofrecombination, indicating that the presence of endonuclease cleavage sites within the a sequence does not account for its recombinogenicity. Finally, byreplacingsegments of the a sequence with DNAfragments ofsimilar length, we have determined that onlythe95-bp

UC-DR1

segmentisindispensable for high-level a-sequence-mediated recombination.

Herpes simplex virustype 1 (HSV-1) is anenveloped virus with a 152-kb linear duplex DNA genome. There are two unique regions in the HSV-1 genome, termed UL (unique long) and

US

(unique short). These are flanked by repeated regions, such that the final structure can be represented as a,,b-UL-b

a,,,'c'-Us-ca

(41). Recombinationoccursthroughthe inverted repeats during HSV-1 infection, giving rise to four equimolar isomeric forms that differinthe orientation of their unique regions (18, 23, 45). There is considerable evidence that thisinversion process occursthroughthe HSV-1 a sequences. Insertion of fragments containingana sequence into the viral thymidine kinase gene produces new inversions in regions flanked by the inverted a repeats (32, 50) and deletions of regions with directly repeated a sequences at their ends (32, 50). In addition, the few noninvertingmutantsof HSV-1 that have beenidentified contain large deletionsencompassingthe a sequences atthe

UL-US

junction (25,37).

The HSV-1 a sequencevaries from 200 to500bp in length and is approximately 83% G+C. The a sequence is essential forcleavageandpackaging of HSV-1(35,56)andalso includes the promoter for the ICP34.5 gene (10). The a sequence contains 20-bp direct repeats (DR1) at each end and two

unique segments (Ub and

UJ)

separated by arrays of direct repeats. The composition of the internal directly repeated elements oftheasequencevaries from straintostrain(15,31, 33, 55,56),butallcontainanarrayof12-bpDR2 repeats.The DR2 repeatshaveseveralfeatures that couldpotentially playa

role in a-sequence-mediated recombination. They have been shown to adopt a novel DNA conformation under the

influ-ence ofnegative supercoiling (62, 63), and they are sites for cleavage byaHSV-1-induced endonuclease (61).

High-level recombination between either a sequences or other pairs of homologous sequences requires both HSV-1 infectionand replicationof the DNAcontaining the repeated

*Correspondingauthor.

sequences. Recombination between inverted repeats ofthea sequence that had been stably integrated into the cellular genomealong withaflanking HSV-1 origin of replicationwas shown to occur only in conjunction with HSV-1-dependent amplification (34). Similarly, recombination between Tn5 re-peats within plasmids was observed only in association with HSV-1DNAreplication (58).Ourprevious studies of recombination between a sequences inplasmids transiently introduced into Vero cells confirmed that high levels of recombination wereseen only when theplasmids underwentreplicationinHSV-1-infectedcells (20).Analysis of the time courseofHSV-1 recombinationand replication indicated that the two processes parallel each other,and directquantitationof theproductsof recombination by Southern analysis demonstrated that recombination oc-curred during or subsequent to the last round of DNA replication (20).

The exact nature of the high-level a-sequence-mediated recombination remains unclear. HSV-1-infected cells show high levels of homologous recombination, and repeated

re-gions such as the HSV-1 Bam L sequence(38), the HSV-1 b sequences(30),orthe TnS repeats(58) canmediate inversion

events. The a sequence does, however, appear to be more

highly recombinogenic than other sequences: Weber and

co-workersdemonstrated that the3.0-kb b-a-cjunctionwasmore recombinogenic thana3.0-kbplasmidsequence(59), andour

previous work showed that recombination between a

se-quences was twice as efficient as recombination between a

differentset of direct repeats ofthe samesize(20). Recombi-nation betweenasequencescould beenhancedeither because itis ahot spot forhomologousrecombination orbecause itis

actedonbyasite-specific recombinase.The findingthatthea

sequencesofHSV-1 and HSV-2,which have little homology, areincapable ofrecombiningwith each other arguesagainsta site-specific mechanism (51). However, the simple conditions of an in vitro system for a-sequence recombination (7) are

indicative ofasite-specific mechanism.

In thisreport,wedescribe ourcontinuedstudies of

recom-3733

on November 9, 2019 by guest

http://jvi.asm.org/

bination with plasmids transiently introduced into Vero cells.

We find that directrepeatsfrom avarietyofsourcesand with awiderangeof G+Ccontentgive essentiallyidentical recom-bination frequencies. However, directly repeateda sequences

show recombination frequenciesthat are twice thatseenwith

the other sequences. Introduction ofa cleavage site for the

a-sequenceendonuclease identifiedbyWohlrab and coworkers

(61) does not increase the frequency ofrecombination,

indi-cating that the presence of cleavage sites for this enzyme

cannot account for the recombinogenic nature of the a se-quence. Finally, replacement of portions of the a sequence

with DNAsegmentsof similarlengthshowed that theUc-DR1 region contains the cis signals required for high-level

a-se-quence-mediated recombination.

MATERIALS ANDMETHODS

Cells and viruses. All tissue culture experiments were

carried out with Vero cells (African green monkey kidney fibroblasts) obtained from the American TypeCulture

Collec-tion. Cells were propagated in Dulbecco modified Eagle minimum essential mediumsupplementedwith 10% fetal calf

serum,0.1 mM nonessential aminoacids,and 2 mMglutamine. The HSV-1 strain F(A305) (39) was used.

Plasmid construction. All restriction enzymes and linkers

usedinplasmidconstructionwereobtained from NewEngland Biolabsorthe United States BiochemicalCorp.Plasmidswere

prepared either by alkalinelysisfollowed by subsequent CsCl

gradient purification (43) or by the alkaline lysis procedure

followedby purification on Qiagen columns according tothe

manufacturer's instructions. Thetwomethodsgave essentially

thesameresultsin transfectionexperiments.All DNAsamples foranindividual transfectionexperimentwereprepared bythe

samemethod.

PlasmidpRD107 (20) wasused asthe parentvectorfor all

constructions. This plasmid contains the ampicillinresistance

gene and the origin ofreplication of pUCl9, permitting its

propagation in Escherichia coli. It also contains the complete lacZ gene with ribosomal bindingsites that allow transcripts madeby runoff transcription tobe translated. Upon transfor-mation with pRD107, E. coli DH5ot (RecA- LacZ-) gives deep blue colonies when plated in the presence ofampicillin and 5-bromo-4-chloro-3-indolyl-fi-D-galactopyranoside (X-Gal). In

addition,pRD107containsan HSV-1 originofreplication, Orin,

which allows theplasmid toreplicate inHSV-1-infected cells. Plasmidscontaining directrepeatsofhomologoussequences were prepared by inserting acopy of the desired insert into

both the XbaI andBamHIsitesofpRD107,sothat the inserts

were positioned in directly repeated orientation. In all cases,

the insertswere prepared for insertion by preliminary

restric-tion digestion, addition of either XbaI or BamHI linkers, digestion withXbaI orBamHI, purification on agarose-TAE

(40mMTris-acetate, 1 mMEDTA) gels, andelution from the

agarosegel with an Elutrap electrophoresis chamber

(Schlei-cher & Schuell). For pRDMS2, the insert was a 374-bp

PstI-to-SacIIfragment from themouseNa+/K+ ATPasegene,

kindly provided by S. Ying Tam, Harvard Medical School. For pRDBR2, the insertwasa378-bp SphI-to-EagI fragment from

pBR322 (nucleotides 562to939). This fragment containedno

partoftheparent vector,pRD107. pRD+X2 contained 400-bp insertsgenerated by SspI-DraI digestion of XX174 (nucleotides 1007to 1406; New England Biolabs). The 390-bp fragment in pRDU32wasfromtheyeastURA3gene,generated byaStuI-NsiI

digestofyRP17 (nucleotides 3556to3945). pRDSVS2 containeda

370-bp insert from aHinclI digest of simianvirus 40

(nucle-otides 2297 to2666). ForpRDUbx2, a380-bp fragmentfrom

an ApaI-PstI digest of

p(UT)2(Hind)D-33/t3CAT

(27)

was used. This insert contains

multiple copies

of the Ubx DNA binding site fromDrosophilamelanogaster.

Finally,

pRD1 10,as described previously (20), contains an insert from the

d-signaling gene

(dsg)

of Myxococcus

xanthus,

provided by

YvonneChengand DaleKaiser,Stanford

University. pRD105,

also described previously

(20),

contains two

copies

of the a sequencefrom HSV-1 strain KOS,provided byJames

Smiley,

McMaster University.

Toconstructplasmidsubstrates

containing cleavage

sites for the

a-sequence-specific

endonuclease

reported by

Wohlrabet

al.

(61), (dG)25

and

(dC)25 oligonucleotides

flanked

by

XhoI

sites were obtained from the PAN

facility,

Beckman

Center,

StanfordUniversitySchool of Medicine. The

oligonucleotides

wereannealed bymixing equal volumes, heatingto

85°C,

and then cooling to room temperature. The annealed

oligonucle-otideswerethendigested overnightwithXholand

purified

on a4% NuSieve

low-melting-point

agarose

gel

(FMC

BioProd-ucts). The vectors pRDMS1 (pRD107 containing only one mouse Na+/K+ ATPase insert) and pRD111

(pRD107

with

onedsg insert) were prepared for insertionby

cleavage

with

XhoI,

which cuts once in the mouse and dsg inserts and for which thereare nosites in theparentvectorpRD107.Insertion of the

(dG)25

*

(dC)25 oligonucleotide

into the

prepared

vec-tors resulted in

plasmids

msendol and dsgendol. A second copy of the mouse and dsg inserts now

containing

the endo-nucleaserecognitionsitewasthen addedtotheBamHI site of thevectorssuch thatthe repeatswerecompletelyhomologous and in the directly repeated orientation, creating

plasmids

msendo2 anddsgendo2. Finally,plasmid dsgmsendowas con-structedbyinsertingacopyof themouseNa+/K+ATPasewith inserted

(dG)25

*

(dC)25

into the BamHI site of

dsgendol.

Thus, this plasmid has two nonhomologous inserts, both

containingthe endonuclease site.

Plasmids for analysis of the recombinogenic properties of variousregionsof theasequencewereconstructedby remov-ing portions of the a sequence and replacing them with segmentsof thedsgsequence.Thewild-typea sequencefrom HSV-1 strain KOS is 317 bp in length and contains both

direct-repeatandunique regionssuch thatits finalstructureis

DRl-Ub-(DR2)1,-Uc-DRI

(56).

PlasmidpRDUb-2wasconstructedinthefollowingmanner.

The317-bpa sequencewasremoved frompRD105byBamHI

digestion, isolatedon a1% agarose-TAEgel,and

purified

by Elutrap. This fragmentwasthen digestedwith therestriction enzyme EaeI, and the resulting 222-bp DNA

fragment,

with the sequence

EaeI-(DR2-Uc-DR1)-BamHI,

was

gel

purified

and isolated by Elutrap. The required dsg fragment was generated bydigestionofpRD111withCspI,addition ofEagI

linkers(EagIandEaeIproducecompatiblecohesive

ends),

and digestionwith BamHI andEagI.The

resulting 120-bp fragment

was

purified

by

using

a1%agarose-TAE

gel

and

Elutrap.

This

BamHI-(dsg)-Eagl

fragment was cloned into the Bluescript

cloning

vector

(Stratagene)

cutwith BamHI and

EagI

toobtain sufficient quantities of DNA and again excised and

purified

priorto use.Theasequenceanddsg fragmentswerejoined by

simultaneous insertion into the Bluescript vector

previously

digested with

BamHI,

giving a 342-bp insert of structure

BamHI-(dsg-DR2-Uc-DR1)-BamHI.

This insert was

placed

into the XbaI site of pRD107

(XbaI

linkers added prior to insertion) togive

pRDUb-1

and thenintotheBamHI site of

pRDU,-

1 toyield pRDUb-2.

Toconstruct plasmid pRDR2-2, twoa-sequence

fragments

were needed. The first, containing the

DR1-Ub portion,

was generated bycleavingthepurified 317-bpasequencewithEaeI and

purifying

the

resulting 95-bp fragment through

1%

on November 9, 2019 by guest

http://jvi.asm.org/

rose-TAEandElutrap, givingafragment ofstructure

BamHI-(DR1-Ub)-EaeI. The DNA fragment containing the

Uc-DR1

wasgenerated by digestion of pRD105 with DraI andSphI,gel and Elutrap purificationoftheresulting270-bpfragment,and digestion withMnlI for 6 h to remove the DR2 region. The resulting fragmentwasthenfilled in with the Klenow fragment ofDNApolymerase I.XhoI linkerswere added, and product

wasdigestedwith BamHIandXhoI. The final 100-bp fragment, with the structure

XhoI-(Uc-DR1)-BamHI,

was gel and Elu-trappurified. Finally,the desireddsg fragmentwasconstructed

by cleavageofpRD109 with BamHI andStuI, addition of EagI

linkers, digestion with XhoI and EagI, and gel and Elutrap

purification. This 126-bp fragment, XhoI-(dsg)-EagI, was cloned into Bluescript previously digestedwithXhoIandEagI in order toobtain sufficient quantities of the DNA. Once the three required fragments were obtained, the

BamHI-(DRI-Ub)-EaeI andEagI-(dsg)-XhoI pieceswereligatedby simulta-neous insertion into Bluescript previously digested with BamHIandXhoI. Thisplasmidwasgrownin large quantities, and the221-bp insertwas cut outwithBamHI andXhoI and

purified.Next, this

BamHI-(DR1-Ub-dsg)-XhoI

fragmentand the

XhoI-(Uc-DR1)-BamHI

DNA werejoined by double in-sertion into Bluescript previously digested with BamHI. This

procedure generatedthe final321-bpinsert,

BamrHI-(DR1-Uh-dsg-Uc-DR1)-BamHI,

whichwassubsequentlycloned into the XbaI site of pRD107(using XbaI linkersonthe insert)togive

pRDR2-1and then into theBamHI site of pRDR2-1in direct orientation togivepRDR2 2.

Threefragmentswere alsorequiredtogenerate

pRDUc-2.

The first,the95-bp

BamHI-(DR1-Ub)-EaeI

fragment,wasthe

same asdescribed forpRDR2-2. Thesegmentcontainingthe DR2 region was isolated by cleavage of pRD105 with SstII, purification of the 217-bp fragment generated, cleavage by DraI andEaeI,and isolation of the resulting 122-bp fragment

[EaeI-(DR2)-SstII].Thesetwosegmentswereligated by

simul-taneous cloning into Bluescript previously digested with

BamHI and SstII to give BamHI-(DR1-Ub-DR2)-SstII. Next, the dsg fragment described for pRDR2-2 was inserted by

blunt-end ligation into the Sacl site of the Bluescript vector containing the required portions of thea sequence. Cleavage

of the resulting plasmidwithBamHI and RsaI (which cleaves

near the end ofthe inserted dsg sequence) yielded a 337-bp

insert with structure

BamHI-(DR1-Ub-DR2-dsg)-RsaI

con-taining 12 bp ofBluescript vectorbetween the DR2 and dsg sequences.Thisinsertwascloned into theXbaI siteofpRD107 (usingXbaI linkers) to createpRDU- 1 andinto theBamHI site of

pRDUc-

1 in direct-repeat orientation to give

pRDUC-2.

Thecorrect construction of the three replacement constructs was confirmedby DNAsequencing.

Transfection, infection,and DNA isolation.Actively growing Verocellsat aconcentration of5 x

106

to7 x

106

cells per ml

wereelectroporated (12) at220 Vwith20 ,ugof the indicated

plasmid.Cellswereallowed to recoverforapproximately24 h. The transfected cells were then infected with 10 PFU/cell HSV-1

F(A305)

in 3 mlof mediumormock infected with3 ml of medium. Virus and medium were removed after 1 h, the cells were washed twice with phosphate-buffered saline (ob-tained from Gibco), and the mediumwasreplaced.

DNA was extracted from the transfected cells using the RAPP procedureas described previously (20).

Transformation, miniprepisolation ofDNA,and restriction analysis. Competent frozen E. coliDH5oc cells (0.2 ml) were prepared and transformed with 20 to 100 ng of DNA bythe method of Hanahan (22) except that the growth medium consistedof5gof Bacto YeastExtract,20 gofBactoTryptone, and 5 gofMgSO4perliter. The cellswere platedwith 100 ,ug

of carbenicillinand 50 Figof X-Gal per ml. Miniprep isolation ofDNA from white colonies wasperformed by the modified boiling procedure(43), with 50 mM Tris-Cl (pH 8.0)-62.5 mM EDTA-0.4% Triton X-100-2.5 M LiCl used as the resuspen-sion buffer. The DNA was digested with Dral for 2 h and electrophoresed through 1% agarosegels in TAE.

Cleavage of plasmid DNA in vitro. A 0.4 M NaCl extract was prepared from nuclei of HSV-1-infected Vero cells, centri-fugedat 100,000 xg,andprecipitated with ammoniumsulfate aspreviously described (7). The dissolvedprecipitate was then dialyzed and applied to a column of heparin-agarose and elutedwitha50ml0.1 to 1.0 MNaClgradient. The0.5 MNaCl heparin-agarose fraction contains the a-sequence-specific cleavage activity.

One microgram of plasmid DNA linearized with SspI was incubated with 500 ngof the heparin-agarose fraction for 10 min at 37°Cin a bufferconsisting of 25 mM N-2-hydroxyeth-ylpiperazine-N'-2-ethanesulfonic acid (HEPES;pH7.6), 1 mM dithiothreitol, 1 mM spermidine,2 mMMgCl2, 1 mM EDTA, and 50 mM NaCl. EDTA (10 mM) was used to stop the reaction, after which theDNA waspurified by using the Magic DNACleanup System (Promega, Inc.).

Two hundred nanograms ofenzyme-treated DNA was di-gested with FspI and Scal, precipitated, and resuspended in 80% formamide-1x Tris-borate-EDTA(TBE) loading buffer. Thesampleswereboiled, chilledon ice, andloaded onto an 8 M urea-1.2X TBE 5% Long Ranger gel (J. T. Baker, Inc.). Thegelwas runwith 0.6x TBEbufferat27Wand50 to55°C. Following electrophoresis, thegelwasequilibrated for20 min in 1xNAQ buffer(80mMTris-HCl, 118 mMborate,2.4 mM EDTA [pH 8.3]). The DNA was then transferred with 1X NAQ buffer onto a 0.22-pLm-pore-size Nytran membrane

(Schleicher&Schuell)at2.5

mA/cm2

for I h, usingaGraphite Electroblotter II (Millipore, Inc.). Following transfer, the membranewas rinsed with 5x SSC(Ix SSC is 0.15 M NaCl plus0.015 M sodium citrate), and theDNA was immobilized onto the damp membrane by cross-linking in a Stratalinker oven (Stratagene, Inc.)with aUV doseof 120 mJ/cm2.

Bandswere detected in thefollowing manner. Oligonucle-otides CGCGATCTGGCGACCACACCCGTCC and CCAC AGGACGGGTGTGGTCGCCAGATCGCG were tailed at their 3' ends withdigoxigenin-11-dUTP/dATPby using termi-naltransferaseandusedtoprobe the membrane accordingto instructions provided with Genius 6 kit (Boehringer Mann-heim, Inc.). The membrane was then processed with anti-digoxigenin antibody coupled to alkaline phosphatase and Lumigen PPDchemiluminescentsubstrate, using the Genius7 kit and instructions suggested by the manufacturer (Boehr-inger Mannheim). Followinga2-hincubationatroom temper-ature in the dark, the membrane was exposed to Hyperfilm ECL X-ray film (Amersham, Inc.) for 30 min. The film was developed in an automated film developer (Eastman Kodak, Inc.).

Assay for recombination frequency. The assay used to

measure recombination between sets of direct repeats has been previously described (20). Briefly, plasmids containing

directly repeatedsequencesflankingalacZ genewere electro-poratedinto Verocells,andthe cellswereinfected with HSV-1

ormock infected.Eighteenhours afterinfection,the DNAwas

isolatedbythe RAPPprocedureand thentransformed into E. coliDH5cx.The number of blue andwhitecolonieswasscored

todeterminethefrequencyoflacZdeletion.Sinceeventsother than recombination between the direct repeatscanleadtoloss of a functional lacZ gene, the DNA was isolated from a fraction of thewhite colonies bythe miniprepprocedure and examinedbyrestriction analysis.

on November 9, 2019 by guest

http://jvi.asm.org/

TABLE 1. Comparisonof recombination frequencieswithplasmidscontainingdirectrepeats

Plasmid Source of DNAinsert % G+C HSV-1infection"

%l

White colonies

(SDe)

Totaln. Avg whites Expt I Expt2 Expt 3 of colonies colonies

pRD105 a sequence 83 - 0.2(0.1) 0.5(0.2) 0.4(0.2) 2,875 0.4

+ 8.7(0.8) 9.8(1.9) 12.6(1.0) 2,433 10.4

pRDMS2 Mouse Na!/K+ 73 - 0.2(0.1) 0.3(0.2) 0.2(0.1) 3,181 0.2

ATPase

+ 4.5 (0.4) 2.5(0.6) 3.9 (0.5) 4,632 3.6

pRD110 M. xanthus dsg 65 - 0.4(0.2) 0.2(0.2) 0.6(0.2) 2,759 0.4

+ 3.4 (0.4) 5.7(1.0) 3.3(0.5) 3,696 4.0

pRDBR2 pBR322 60 - 0.2(0.1) 0.6(0.3) 0.5(0.2) 3,012 0.4

+ 3.7(0.4) 3.1(0.5) 5.9(0.6) 4,926 4.2

pRD+X2 fX174 45 - 0.2(0.1) <0.4 0.4(0.4) 1,996 0.3

+ 3.5 (0.4) 3.5(0.8) 6.7 (0.6) 4,602 4.6

pRDU32 YeastURA3gene 42 - 0.6(0.3) <0.4 0.6(0.3) 2,062 0.5

+ 4.7 (0.6) 2.2(0.6) 3.0((1.7) 2,261 3.3

pRDSVS2 Simian virus40 40 - 0.4(0.2) 0.1 ((.1) 0.2(0.1) 2,704 0.2

+ 3.0(0.5) 3.5(0.5) 4.3(1.0) 2,629 3.6

pRDUbx2 D. melanogaster Ubx 22 - <0.1 <0.1 0.4(0.2) 3,030 0.2

binding sites

+ 3.1(0.6) 2.8(0.5) 4.9(0.6) 3,329 3.6

"Transfectedcells were either infected with HSV-1 (+)or mockinfected(-). "Calculatedas[(1-frequency) (frequency)/numberofcolonies]"2.

RESULTS

Recombination between a sequences occurs at twice the frequencyof recombination betweenany other set of homolo-gous sequences. Wehad previously shown that recombination betweenasequencesinreplicating plasmids is twiceasefficient as that seen between two directly repeated copies of dsg, a

segmentofDNAfromM.xanthus of similar size but with no significant homology to the a sequence (20). To determine whether the high G+C content of the a sequence (83%) is responsible for the increasedfrequency ofrecombination,we constructed six plasmids with the repeats all 370 to 400 bp (compared withthe317-bpasequence) but with G+Ccontent varying from 22 to 73%.

In the absence of superinfection with HSV-1, all of the plasmids showed a low level of recombination (<1% white colonies), consistent withourpreviousfinding (20), and there was nosignificant difference inthe recombination frequencies ofany ofthe plasmids (Table 1).

In the presence of HSV-1 infection, all plasmids showed a greatly increased frequency of recombination. As before, pRD105, containing theasequences, gaveanaverageof10.4% whitecolonies, andpRDI10, the plasmid withdirectlyrepeats dsg sequences, showed a recombination frequency less than halfthatofthea-sequence-containing plasmid (4%).Allother repeated sequences recombined with a frequency similar to thatof thedsgsequence, regardless of thesourceofthe DNA or their G+C content. Restriction digest analysis ofplasmid DNAfrom thewhite colonies ofeach sample showedthat60 to80% containedaplasmid thatwasconsistent with adeletion through the directly repeated sequences. Thus, we can con-clude that the frequency of homologous recombination

be-tween these direct repeats inplasmids replicating in HSV-1-infected cells is 3 to 4% and is unaffected by G+C content rangingfrom 22 to73%. Recombinationbetween a sequences isat least twiceasefficient, confirming the special recombino-genicproperties of thea sequence.

Addition of sites for an a-sequence-specific endonuclease does not significantly increase recombination between direct repeats.An endonuclease that cleaves within the a sequence has been identified and partially purified by Wohlrab and

coworkers (61). It wassuggested that thisenzyme mayplaya

roleina-sequence-mediated recombination bygenerating dou-ble-strand breaks that could behighlyrecombinogenic.To test this hypothesis, we constructed plasmids in which another substrate for the endonuclease, a duplex oligonucleotide, (dG)25*(dC)25 (61),wasinserted into bothrepeatsofpRD110 and pRDMS2. Toverifythat these sequences werecleaved, a partially purified enzyme fraction from HSV-1-infected nuclei abletocleave theDR2 repeatswithin theasequence(datanot

shown) and which is probably identical to the enzyme de-scribedby Wohlrab and coworkers(61)wasincubatedwith the modified plasmid substrates. The DNA wasthen purified and analyzed by modified Southern analysis. In the absence of enzyme,little cleavage of theDNA occurred with anyof the samples (Fig. 1, lanes 1, 3, 5,and7). Whenenzymewasadded, pRD110 andpRDMS2, which lack the endonuclease substrate insert, showed nosignificant cleavage (Fig. 1, lanes2 and 6). However, the two plasmids with the

(dG)25

*

(dC)25

insert produceda400-bp product for dsgendo2 anda250-bp product for msendo2, as predicted for cleavage at the inserted endo-nuclease site(Fig. 1, lanes4and8). Theamountofcleavageat the

(dG)25

*(dC)25 insertion was similar to that for the a

sequence(data notshown).

When recombination between directrepeatscontaining the

(dG)25*

(dC)25

was examined in uninfected cells, a low fre-quencyofwhite colonieswasobserved(Table 2).Foursamples gavesignificantly highervalues than normally seen.However, these higher values are randomly dispersed, and restriction analysisofthe DNAisolatedfromthe white coloniesshowed veryfewcorrect products.

AfterHSV-1 infection,there was alarge increasein recom-bination frequency (Table 2). pRD105, the a-sequence-con-taining plasmid,showed the highestpercentageof white colo-nies (5.8%). pRD110,with the dsg repeats, again gavewhite colonies at approximately half the frequency seen with pRD105. dsgendo2, formed by addition of the endonuclease substrate site to the dsg sequences, gave recombination fre-quencies thatwereverysimilartothose forpRD11O.Thedata obtained withplasmids pRDMS2 and msendo2are somewhat more complex. pRDMS2 gave 3.0 to 4.4% white colonies in

on November 9, 2019 by guest

http://jvi.asm.org/

cs u) C f en CL 7}a)Q

r---- --ir

_ + _ + _ + _ +

Lane 1 2 3 4 5 6 7 8

FIG. 1. Southern analysis ofendonuclease cleavage of sites

con-taining a (dG)25*(dC)25 insert. The experiment was performed as

described in Materials and Methods. Lanes 1,3,5, and 7,untreated

DNA; lanes 2, 4,6,and8,DNAtreated withenzymefraction. Lanes 1

and 2, pRDI 10; lanes 3 and 4, dsgendo2; lanes 5 and 6, pRDMS2;

lanes 7 and8,msendo2.

five of the six samples. The reason for the high value in

experiment 4 is unclear. The endonuclease insert in msendo

appeared to give significant stimulation in one case (experi-ment 3) but otherwise gave values very similar to those for pRDMS2. Restriction digest analysis showed no significant

difference in the percentage of correct deletion products obtained betweenplasmidswith theendonucleasecleavagesite

andthose lacking this site. Finally, plasmid dsgmsendo, which

contains one dsg-endonuclease cleavage site insert and one

mouse-endonuclease cleavage site insert, gave a very low

frequency of white colonies and nocorrectproducts in restric-tion digest analysis, demonstrating that two homologous se-quences arerequiredevenin thepresenceof thecleavagesites.

We therefore conclude that thepresenceofacleavage sitefor

the a-sequence-specific endonuclease is not sufficient to

ex-plain the consistently high levels of recombination observed between repeateda sequences.

The

UC-DR1

regionof the a sequence is responsible for the high levelof recombination between a sequences. Our studies confirmed thehighlyrecombinogenicnatureof theasequence but indicated that cleavage within the DR2 repeats by the a-sequence endonuclease was not sufficient. We therefore wished to determine which regions of the a sequence were necessary for the high recombinogenicity. Two groups had previouslyperformed deletion analyses of theasequence,with somewhatconflicting results (9, 49), possibly because of vari-ations in the length ofhomologoussequencesexamined. There issignificant evidence that in both prokaryoticandeukaryotic cells, homologous recombination is strongly dependentonthe length of the homologous regions (3, 26, 29, 42, 46, 48,53, 57, 64). Recombination between repeatedsequencesshorter than the minimalefficient processingsegment(approximately220 to 280 bpin mammaliancells) (29, 42) isvery inefficient. Above thissize, there isalineardependenceonlength. Consequently, it is important that the constructs to be tested for their recombination frequency be of similar size. We therefore replaced portions of thea sequence with segmentsofthe dsg sequence such that thelength ofhomologywaskept between 317bp (the size of thewild-typea sequence) and 342 bp. The three constructs (Fig. 2) contain inserts which replace the

DRi-Ub

regions (pRDUb-2), the DR2 repeats (pRDR2-2), orthe

Uc-DR1

regions

(pRDUc-2)

ofthe a sequence.

Inthepresenceof HSV-1 infection, the frequency of recom-bination with

pRDU,-2,

which lacks the

DR1-U1,

region,was similartothatseenwithpRD105, which contains thewild-type asequence(Table3). pRDR2-2, which lacks theDR2 repeats, gave an even higher level of recombination. Replacement of the

Uc-DR1

region,however, reduced recombinationtohalfof thatobtained with thewild-typeasequence.The reduced level of white colony formationseenwith

pRDUc-2

wasconsistent through all of the experiments and was independent of the preparation ofDNA (Table 3,experiment 5). Thus,when the total length ofhomology is keptconstant,eitherthe

DRi-Ub

region ortheDR2 repeats canbereplaced withnosignificant

decrease in recombination frequency, indicatingthat theyare not responsible forthe increasedfrequency of recombination seenwiththea sequence. Instead,thecis signal forhigh-level a-sequence recombination resides in the

Uc-DR1

segment. Replacement of this segment reduces the recombination

fre-TABLE 2. Effects of insertion ofa-sequence-specific endonuclease substratesonrecombination

HSV-1I White colonies (SD) Totalno. Avg l white

Plasmid infection Expt 1 Expt 2 Expt3 Expt 4 Expt5o

of

colonies colonies

pRD110 - 0.3(0.2) 0.6(0.2) 2.8(1.0) 0.1 (0.1) - 4,338 0.9

+ 3.4(0.6) 3.3(0.4) 4.1(1.2) 3.9(0.4) 2.3(0.4),2.8(0.4) 8,985 3.3

dsgendo2 - 3.3(0.7) 0.5(0.2) 0.3(0.2) 2,667 1.4

+ 3.6(0.5) 3.4(0.6) 4.9(0.4) 3.1(0.4),2.9(0.4) 7,856 3.6

pRDMS2 - 1.8(0.6) 0).2(0.1) 0.5(0.2) 0.3(0.1) 4,30)8 0).7

+ 4.4 (0.7) 3.3(0.4) 4.4(0.6) 7.2(0.8) 3.3(0.4), 3.0(0.4) 8,920 4.3

msendo2 - 1.9(0.6) 0.2(0.1) <0.3 0.6(0.2) 3,448 0.8

+ 3.5(0.7) 4.7(0.6) 6.4(0.9) 6.8(0.7) 3.3(0.4) 5,635 4.9

dsgmsendo - 0.4(0.3) 0.3(0.2) 0.1 (0.1) 2,494 0.3

+ 0.5(0.2) 1.6(0.3) 1.4(0.4) 2.2(0.3),0.7(0.2) 6,977 1.3

pRD105 - 0.3(0.2) 0.2(0.1) 0.7(0.4) <0.1 4,176 0.3

+ 5.8(0.6) 4.0(0.6) 6.8(1.3) 8.0(0.8) 5.0(0.3),5.1 (0.4) 8,356 5.8 'HSV-1-infectedsampleswereassayedinduplicate.

notdone.

Enzyme fraction

Uncleaved 4

plasmid

Cleavage products

_-0

on November 9, 2019 by guest

http://jvi.asm.org/

[image:5.612.93.272.80.299.2] [image:5.612.62.562.568.711.2]

Plasmid

pRD105

Insert

DR1-Ub-(DR2)10 - Uc-DR1

dsg - (DR2)10 -UC-DR1

mmmmm- L

pRDUb-2

pRDR2-2

DR1-Ub - dsg - UC-DR1

DRi-Ub- (DR2)10 -

dsg

pRDUC-2

FIG. 2. Constructs with a-sequence replacements. Inserts are

shown incorrectsize proportion, with total lengths being 317 bp for pRD105, 342 bp forpRDUb7-2,321 bp for pRDR2 2, and 337 bp for pRDUC-2.Constructionsaredescribed in Materials andMethods. OI,

segmentsfrom theHSV-1 strain KOSasequence; ,segmentsfrom

theM.xanthusdsggene;M, 12-bpfragment from the polylinker region of theBluescript cloningvector.

quency to the level observed between any set of non-a-sequencedirect repeats.

DISCUSSION

Ourfindings shed newlighton several aspects of recombi-nation in HSV-1-infected cells. First, the verysimilar recom-bination frequencies observed with direct repeats in which G+Ccontentvaried from 22to 73% indicates that there isa

significant level of homologous recombination in replicating plasmids that is independentofG+Ccontent.Second, recom-bination between a sequences occurs at twice the level ob-served with these othersequences.Third,addition ofa

cleav-age site for an a-sequence-specific endonuclease does not significantly increasethe frequency ofrecombination, indicat-ing that cleavage of the a sequence by this enzyme cannot account for the high recombinogenicity of the a sequence.

Finally, the

Uc-DR1

region is the only segment of the a

sequence that is indispensable for the enhanced level of recombination.

Severalgroupshavedescribed thehigh frequencyof homol-ogousrecombination thatoccursinHSV-1-infectedcells(5, 6, 8, 14,24, 44, 52, 60).Weber and coworkers demonstrated that Tn5 undergoes significant homologous recombination when present in the HSV-1 genome or on a replicatingplasmid in

HSV-1-infected cells (58). Although recombination could be detected only downto600bp ofhomology,our moresensitive

assayvery likely explains our ability to detect recombination between 350-to400-bp repeats.

Asnotedabove, changes in G+Ccontent donot affect the frequency of recombination.Wewereunabletotestsequences

with G+C content as high as that of the a sequence (83%) becauseof difficultieswithplasmidconstruction. This leftopen

thepossibility thatan extremely high G+Ccontentisneeded forhigh-levelrecombination.However,oursubsequent finding

that large portions of the a sequence can be replaced with

sequences of lower G+C content without affecting recombi-nation frequencyindicates thatthe high G+Ccontentof thea

sequence isnotthe solecauseof its recombinogenicity.

The findingofanHSV-1-induced endonuclease that

specif-ically cleaves within theasequence(61)ledtospeculationthat cleavagebythis enzyme was responsible forthehigh level of recombination. There is considerable evidence that double-strand breaks in DNA can stimulate recombination (for

re-views, see references 21 and 54). However, it is clear that

cleavage by the a-sequence-specific endonuclease is not

re-sponsible fortherecombinogenicity of theasequence.Possibly

recombination occurs with such high frequency in

HSV-1-infected cells that double-strand breaks do not significantly influencethe total signal.It isalsopossible that cleavage by the a-sequence-specific endonuclease, while readily seen invitro,

did not occur within the infected Vero cells. However, our

finding that theDR2region ofthea sequenceisnot required for high-level recombination reinforces our conclusion that

cleavagewithin the DR2 repeats by the a-sequence

endonu-clease isnotthecauseofthehigh level ofa-sequence-mediated recombination.

Replacement of portions of the a sequence was used to determine whether any regions within the a sequence were

dispensable. Simple deletionsdecrease the amount of

homol-ogy, and asstated earlier,there is considerable evidencethat

thefrequencyofhomologousrecombination isdirectlyrelated

TABLE 3. Effects ofreplacement of regions of thea sequence onrecombination

HSV-1 % White colonies(SD) Totalno. Avg% white

Plasmid ifcino_{infection Expt 1 Expt 2 Expt 3 Expt4" Expt5" of colonies}oois clne_colonies

pRDUt,h-2 - 0.1(0.1) 0.2 (0.1) 0.1(0.1) -' 3,830 0.1

+ 5.7(0.5) 4.8(0.5) 8.5(0.7) 3.5(0.4), 6.0 (0.5),9.1(0.8) 12,267 6.3 6.2(0.8)

pRDR2-2 - <0.1 0.2(0.1) 0.8(0.2) 4,362 0.4

+ 7.3(0.7) 6.8(0.6) 7.6(0.7) 3.5(0.3) 9.4(0.7), 12.4 (0.7) 11,458 7.8

pRDU,J2 - 0.6(0.2) 0.4(0.2) 0.2 (0.1) 3,950 0.4

+ 3.8(0.4) 3.0(0.4) 4.1 (0.5) 3.0(0.5), 3.0(0.3),2.5(0.4), 19,814 3.0 2.5(0.3) 2.9(0.4), 3.0 (0.5),

1.9(0.2)

pRD105 - 0.2(0.1) <0.1 0.3 (0.1) 5,805 0.2

+ 5.8(0.6) 5.7(0.7) 5.5(0.6) 7.9(0.9), 7.2(0.7),9.7(0.6) 9,206 6.8 5.6(1.0)

'HSV-1-infectedsamples were assayed in duplicate.

"HSV-1-infectedsamples forpRDUb-2,pRDR2-2 and pRD105 were assayed in duplicate;HIV-1-infected samples forpRDUc. 2 wereassayedfive times, using three differentpreparaitionsof DNA.

'- notdone.

J

on November 9, 2019 by guest

http://jvi.asm.org/

[image:6.612.71.268.80.253.2] [image:6.612.57.556.553.694.2]

tothe

length

of the

repeated regions (3,

26, 29, 42, 46, 48, 53,

57, 64).

Moreover,

the

317-bp length

of the a sequence from strain KOS is

quite

close in size to the minimal efficient

processing

segmentsize of250 to280 bpseen in mammalian cells

(29,

42).

Since recombination

frequencies

between seg-ments smaller than the minimal efficient processing segment showan

exponential decrease,

any

significant

shorteningofthe a-sequence repeats

might

be expected to greatly affect that

portion

of the

signal

generated by homologous

recombination. Our

replacement analysis

indicates that both the

DRi-Ub

and DR2

regions

of the a sequence are dispensable for

high-level

recombination. In

fact,

pRDR2-2,which lacks the array of DR2 repeats,

gives

the

highest

recombination fre-quency. It is

possible

that these repeats, which are known to

adopt

novel DNA structures

(62, 63), actually

repress

a-se-quence-mediated

recombination. Further

experiments

will be neededto test this

hypothesis.

Ourmost

significant finding

is that the

U,-DRI

region

is the

only

segment of the a sequence that is

indispensable

for

high-level

recombination.

Repeats lacking

this region

consis-tently

recombine at half the

frequency

seen with the full a sequence. The fact that recombination isreducedtothe level

seen with any otherset of

homologous

repeats indicates that removal of the

UC-DR1

region

eliminates the special

recom-binogenicity

associated with the a sequence. The construct

pRDUC-2

does contain a short section of

Bluescript cloning

vector next to the

dsg region,

but the lack ofsequenceeffects

on the level of

homologous

recombination makes it

unlikely

that it is ofany

significance.

The

finding

that the

Uc-DRI region

is

indispensable

is at variance with one deletion

analysis.

Chou and Roizman (9),

studying

the a sequence from HSV-1 strain

F, reported

that deletion of the

Ub

or

Uc

domain didnotaffect

inversion,

while DR4repeatswere

important

and DR2 repeatswere essential for recombination

through

a sequences. Several factors

com-plicated

their

study. First,

use ofthe 153-kb HSV-1 genome makes

quantitation

very

complex.

More

importantly,

theseven constructsexamined varied

considerably

in

size,

from less than 100

bp

towell over500

bp. Thus,

it is difficultto differentiate between

changes

in

background

levels of

homologous

recom-bination and decreases due to removal of

important

portions of theasequence. Itis

interesting

thatinsertion ofa

fragment

containing only

the

U,-DR1

segment gave little inversion in the ChouandRoizman

study.

Itis

possible

that the difference in our

finding

results from the use of a sequences from different strains of HSV-1.

Specifically,

the strain KOS a sequenceusedin our

study

doesnotcontainthe DR4 repeats, but a

portion

ofone DR4 repeat is present inour

Uc

region.

Further

experiments

willbe neededtodetermine whether it is this segment of the

UC

that contains the cis

signals

for

high-level

recombination.

Smiley

and coworkersalso

performed

adeletion

analysis

of thea sequence and concluded that the sequencesat the ends

weremost

important

for inversion

(49).

Though again

compli-cated

by

theuseof the whole viralgenomeand

decreasing

size of

homology,

their results are consistent with our

findings.

Deletions from the

Uc

end of the a sequence decreased recombination muchfasterthan deletionsfrom the

Ub

termi-nus, and a

fragment

of less than 100

bp

that contained the

UC-DR1

(their UbS construct)

was

capable

of

driving

inver-sions. Both of these

findings

areconsistent withourconclusion

that the

U.-DR1

region

contains the cis site for enhanced a

sequence recombination.

The

Uc region

ofthea sequence contains

pac2,

one ofthe two cis sequences essential for

cleavage

and

packaging

of HSV-1.

However,

it is

unlikely

that

cleavage

and

packaging

play arole in recombination. Cleavage and packaging should alsorequire the paclsequencefound in the Ubregion(16,56). Deiss and coworkers (16) found that plasmids with only Uc

could be packaged, but examination of the final products revealed the presenceofUb regions that had been added by

recombination with the helper virus. In our study, miniprep and restriction digest analysis of white colonies from

pRDUbJ2

indicate thatnoadditionsoccurred,demonstrating

that enhanced recombinationcanbeseenin the absenceof the pacl signal found in Ub. In addition, there is considerable evidence that cleavage and packaging are coupled processes. Disruption of packaging, caused by deletions in the packaging signals (17)ormutations inanyof nine differentHSV-1 genes

(1, 2, 4, 19, 36, 40, 47), also prevents processing of high-molecular-weight viral DNA into unit-lengthmonomers.Thus, it islikely thatonce theprocessing of DNA for packaginghas begun, the DNA becomes unavailable for recombination. Finally, we have previously demonstrated that recombination parallels replication through the course of HSV-1 infection, with asignificant signal seenby 6 h postinfection (20). Thus, bothprocessesshouldbe well underwaybeforepackaging has begun.

Several proteins that bind in the a sequence have been identified. Dalziel and Marsden (13) noted the binding of 21-and 22-kDaproteinstotheasequence.Kemble and Mocarski

purified ahost cell protein that bindstothehighly conserved

pac-2element in thecytomegalovirusasequence(28). Finally, Chou and Roizman demonstratedsequence-specificbindingto the

Uc-DR1

region of thea sequencebytwo larger proteins, which theyspeculate tobe ICPI andICP7 (11). The

relation-ship between these proteins and a-sequence recombination remainstobe determined.

The important questionof whether thea sequence isahot spot for homologous recombination or a cis signal for a site-specific enzyme remains unresolved. However, we have

nownarrowed the regionofimportanceto the95-bp

Uc-DRI

region. It should now be straightforward to examine further the DNA requirementsof the system.

ACKNOWLEDGMENTS

Wethank S. Y.Tamfor thegiftof themouseNa+/K+ ATPase gene used in our construct pRDMS2 and F. Bradley Johnson and Mark Krasnowfor thegiftofthep(UT),(Hind)D-33/t3CATplasmidusedin theconstruction ofpRDUbx2.

R.E.D. isapredoctoralfellow of the National Science Foundation. This workwassupported bygrantsAl 26538 and AG02908 from the National Institutes of Health.

REFERENCES

1. Addison, C.,F.J. Rixon, J.W.Palfreyman,M.O'Hara,andV. G. Preston. 1984. Characterisation ofa herpes simplexvirus type 1

mutantwhich hasatemperature-sensitivedefect inpenetrationof cells andassemblyofcapsids. Virology138:246-259.

2. Addison, C.,F.J.Rixon,and V. G. Preston.1990.Herpes simplex virus type 1 UL28 geneproductisimportantfor theformation of

maturecapsids.J.Gen. Virol. 71:2377-2384.

3. Ahn, B.-Y.,K.J. Dornfeld,T.J. Fagrelius,and D. M.Livingston. 1988.Effect of limitedhomologyongene conversionina Saccha-romycescerevisiaeplasmid recombination system. Mol. Cell. Biol. 8:2442-2448.

4. Al-Kobaisi,M.F., F.J. Rixon, I.McDougall,and V. G.Preston. 1991.Theherpes simplexvirus UL33 geneproductisrequiredfor the assemblyof fullcapsids. Virology 180:380-388.

5. Brown, S. M., D. A. Ritchie, and J. H. Subak-Sharpe. 1973. Genetic studies withherpes simplexvirus type 1. The isolation of

temperature-sensitive mutants, their arrangement into

comple-mentation groups and recombinationanalysis leadingtoalinkage

map.J.Gen.Virol. 18:329-346.

on November 9, 2019 by guest

http://jvi.asm.org/

6. Brown, S. M., J. H.Subak-Sharpe, J. Harland,and A. MacLean. 1992.Analysis of intrastrainrecombination inherpes simplexvirus

type 1 strain 17 andherpes simplexvirustype2 strainHG52 using

restriction endonuclease sitesasunselected markers and

temper-ature-sensitive lesionsasselected markers. J. Gen. Virol. 73:293-301.

7. Bruckner, R.C.,R. E.Dutch,B. V.Zemelman,E. S.Mocarski,and

I. R. Lehman. 1992. Recombination in vitro between herpes

simplex virus type 1 a sequences. Proc. Natl. Acad. Sci. USA 89:10950-10954.

8. Bubley, G. J., and L. E. Schnipper. 1987. Effect of Bloom's syndromefibroblastsongeneticrecombination andmutagenesisof herpes simplexvirustype1. Somatic Cell Mol. Genet. 13:111-117. 9. Chou, J.,and B. Roizman. 1985. Isomerization ofherpes simplex virus Igenome:identification of thecis-actingand recombination siteswithin the domain of theasequence.Cell 41:803-811. 10. Chou, J.,and B. Roizman. 1986. The terminala sequenceof the

herpes simplexvirus genome contains the promoter ofa gene

located in the repeat sequences of the L component. J. Virol. 57:629-637.

11. Chou, J., and B. Roizman. 1989. Characterization of DNA se-quence-common and sequence-specific proteins binding to cis-actingsites forcleavageof the terminala sequenceof theherpes simplexvirus 1 genome.J. Virol. 63:1059-1068.

12. Chu, G.,H.Hayakawa,and P.Berg. 1987.Electroporationfor the efficient transfection of mammalian cells with DNA. Nucleic Acids Res. 15:1311-1326.

13. Dalziel, R. G., and H. S. Marsden. 1984. Identification of two

herpes simplexvirustype1-inducedproteins (21Kand22K)which interactspecificallywith thea sequence ofherpes simplexvirus DNA.J. Gen. Virol. 65:1467-1475.

14. Dasgupta, U. B., and W. C. Summers. 1980. Genetic recombina-tion of herpes simplex virus, the role of the host cell and UV-irradiation of the virus. Mol. Gen. Genet. 178:617-623. 15. Davison, A.,andN. Wilkie. 1981. Nucleotidesequenceof thejoint

between the L and Ssegmentsofherpes simplexvirus types1 and

2.J. Gen. Virol. 55:315-331.

16. Deiss,L.P., J. Chou, and N. Frenkel. 1986. Functional domains within theasequenceinvolved in thecleavage-packagingofherpes simplexvirus DNA. J. Virol. 59:605-618.

17. Deiss,L.P.,and N. Frenkel. 1986.Herpes simplexvirusamplicon: cleavageof concatemeric DNA is linkedtopackagingandinvolves amplification of the terminally reiterated a sequence. J. Virol.

57:922-941.

18. Delius, H.,andJ.B. Clements. 1976. Apartialdenaturationmap

ofherpes simplexvirustype1DNA: evidence for inversion of the

unique DNAregions. J. Gen. Virol. 33:125-133.

19. Desai, P., N. A. DeLuca, J. C. Glorioso, and S. Person. 1993. Mutations inherpes simplexvirustype1genesencoding VP5and VP23 abrogate capsid formation and cleavage of replicated DNA. J. Virol. 67:1357-1364.

20. Dutch,R.E.,R. C.Bruckner,E. S.Mocarski,andI.R. Lehman.

1992. Herpes simplexvirus type I recombination: role of DNA replicationand virala sequences.J. Virol. 66:277-285.

21. Haber, J.E. 1992.Exploringthepathwaysofhomologous

recom-bination. Curr. Opin.Cell Biol. 4:401-412.

22. Hanahan, D. 1985.Techniques for transformation of E. coli, p.

109-135. In D. M. Glover (ed.), DNA cloning: a practical

ap-proach,vol. 1. IRLPressLtd.,Oxford.

23. Hayward, G. S., R. J. Jacob, S. C. Wadsworth, and B. Roizman. 1975.Anatomy ofherpes simplex virus DNA: evidence for four populationsof molecules that differ in the relativeorientations of their long and short components. Proc. Natl. Acad. Sci. USA 72:4243-4247.

24. Honess,R.W.,A.Buchan,I.W. Halliburton, and D. H. Watson.

1980.Recombination andlinkage between structural and

regula-torygenesofherpes simplexvirustype 1:studyof the functional organizationofthegenome. J. Virol. 34:716-742.

25. Jenkins, F. J., and B. Roizman. 1986. Herpes simplex virus 1

recombinants with noninverting genomes frozen in different iso-meric arrangements are capable ofindependent replication. Vi-rology59:494-499.

26. Jinks-Robertson, S., M. Michelitch, and S. Ramcharan. 1993.

Substrate length requirementsfor efficient mitotic recombination inSaccharomycescerevisiae.Mol. Cell. Biol. 13:3937-3950. 27. Johnson,F.B.,and M. A.Krasnow. 1992. Differentialregulation

oftranscription preinitiation complex assembly byactivator and repressorhomeodomainproteins.Genes Dev.6:2177-2189. 28. Kemble, G.W.,andE. S. Mocarski.1989.Ahost cellproteinbinds

to ahighlyconservedsequenceelement(pac-2)with the cytomeg-alovirusa sequence. J.Virol. 63:4715-4728.

29. Liskay, R. M.,A. Letsou, andJ. L. Stachelek. 1987. Homology requirement for efficient gene conversion between duplicated

chromosomal sequences in mammalian cells. Genetics 115:161-167.

30. Longnecker,R.,and B.Roizman. 1986.Generation ofaninverting

herpes simplex virus I mutant lacking the L-S junction a

se-quences,anoriginof DNAsynthesis,and severalgenesincluding

those specifying glycoprotein E and the (47 gene. J. Virol. 58:583-591.

31. Mocarski, E. S., L. P. Deiss, andN. Frenkel. 1985. Nucleotide sequenceandstructural features ofanovelUs-ajunctionpresent inadefectiveherpessimplexvirusgenome.J.Virol. 55:140-146. 32. Mocarski, E. S., L. E. Post, and B. Roizman. 1980. Molecular

engineering of the herpes simplexvirus genome: insertion of a

second L-Sjunctioninto thegenomecausesadditionalinversions. Cell 22:243-255.

33. Mocarski, E. S., and B. Roizman. 1981. Site-specific inversion sequenceof theherpessimplexvirusgenome: domain and

struc-tural features. Proc. Natl. Acad.Sci. USA 78:7047-7051. 34. Mocarski, E. S., and B. Roizman. 1982. Herpesvirus-dependent

amplification and inversion of cell-associated viral thymidine

kinasegeneflankedbyviralasequencesandlinkedto anoriginof viral DNAreplication.Proc.Natl. Acad.Sci. USA 79:5626-5630. 35. Mocarski,E.S.,and B. Roizman. 1982. Structure and roleofthe

herpessimplexvirusDNAtermini ininversion,circularization and

generationofvirionDNA.Cell 31:89-97.

36. Pertuiset,B.,M. Boccara, J. Cebrian,N.Berthelot,S. Chouster-man, F. Puvion-Dutilleul, J. Sisman, and P. Sheldrick. 1989.

Physical mapping and nucleotide sequence ofa herpes simplex

virustype 1gene requiredforcapsid assembly.J. Virol. 63:2169-2179.

37. Poffenberger, K. L.,E.Tabares, and B. Roizman. 1983. Charac-terization ofaviable, noninverting herpes simplexvirus I genome derivedby insertion and deletion ofsequencesatthejunctionof componentsL and S. Proc. Natl. Acad. Sci. USA80:2690-2694. 38. Pogue-Geile, K. L., G. T.-Y. Lee, and P. G. Spear. 1985. Novel

rearrangementsofherpessimplexvirus DNAsequencesresulting

fromduplicationofasequencewithin theunique regionof theL component. J.Virol. 53:456-461.

39. Post,L.E.,S. Mackem,and B. Roizman. 1981. Regulation of (x genes of herpes simplex virus: expression of chimeric genes produced by fusionofthymidine kinase with et gene promoters.

Cell 24:556-565.

40. Preston,V.G., J.A.V.Coates,and F.J.Rixon.1983.Identification and characterization of a herpes simplex virus gene product requiredforencapsidationof virusDNA. J.Virol. 45:1056-1064. 41. Roizman, B.,and A. Sears. 1990.Herpessimplexviruses andtheir

replication,p. 1795-1843.In B. N. Fields andD.M.Knipe(ed.), Virology. RavenPress,NewYork.

42. Rubnitz, J., and S. Subramani. 1984. The minimumamount of

homologyrequiredforhomologousrecombinationinmammalian cells. Mol. Cell.Biol. 4:2253-2258.

43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular

cloning:apractical approach,2nd ed. ColdSpringHarbor Labo-ratory, ColdSpring Harbor,N.Y.

44. Schaffer, P.A., M.J. Tevethia,and M. Benyesh-Melnick. 1974. Recombination betweentemperature-sensitive mutantsofherpes simplexvirustype1.Virology58:219-228.

45. Sheldrick, P.,and N.Berthelot. 1975. Inverted repetitions inthe chromosome ofherpessimplexvirus. Cold SpringHarborSymp. Quant. Biol.39:667-678.

46. Shen, P.,and H. V.Huang. 1986. Homologousrecombination in Escherichiacoli: dependenceon substrate length and homology.

Genetics 112:441-457.

47. Sherman, G.,and S. L.Bachenheimer. 1987. DNAprocessingin

on November 9, 2019 by guest

http://jvi.asm.org/

temperature-sensitive morphogenic mutants of HSV-1. Virology 158:427-430.

48. Singer, B. S., L. Gold, P. Gauss, and D. H. Doherty. 1982. Determination of the amount of homology required for recombi-nation inbacteriophage T4. Cell 31:25-33.

49. Smiley, J. R., J. Duncan, and M. Howes. 1990. Sequence require-ments for DNArearrangement induced by the terminal repeat of herpessimplexvirus type 1 KOS DNA. J. Virol. 64:5036-5050. 50. Smiley, J. R., B. S. Fong, and W.-C. Leung. 1981.Construction of

a double-jointed herpes simplex viral DNA molecule: inverted repeats are required for segment inversion, and direct repeats promotedeletions. Virology 113:345-362.

51. Smiley, J. R., C. Lavery, and M. Howes. 1992. Theherpes simplex virus type 1 (HSV-1) a sequence serves as a cleavage/packaging

signal but does not drive recombinationalgenome isomerization

when it is inserted in the HSV-2 genome. J. Virol. 66:7505-7510. 52. Stow, N. D., J. H.Subak-Sharpe, and N. M. Wilkie. 1978. Physical mapping of HSV1 mutations by marker rescue. J.Virol. 28:182-192.

53. Sugawara, N., and J. E. Haber. 1992.Characterizationof double-strandbreak-induced recombination:homology requirementsand single-stranded DNA formation. Mol. Cell. Biol. 12:563-575. 54. Thaler, D. S., and F. W. Stahl.1988. DNA double-chain breaks in

recombination of phage X and of yeast. Annu. Rev. Genet. 22:169-197.

55. Umene, K. 1991. Recombination of the internal direct repeat element DR2 responsible for the fluidity of thea sequence of

herpessimplexvirus type 1. J. Virol. 65:5410-5415.

56. Varmuza, S. L., and J. R. Smiley. 1985. Signals for site-specific cleavageofHSV DNA: maturationinvolvestwoseparatecleavage

events atsitesdistaltotherecognitionsequences.Cell 41:793-802. 57. Watt,V. M.,C.J. Ingles,M. S. Urdea, and W.J.Rutter. 1985.

Homology requirements for recombination in Escherichia coli. Proc. Natl.Acad. Sci.USA 82:4768-4772.

58. Weber,P.C.,M. D.Challberg,N.J. Nelson,M.Levine,andJ. C. Glorioso. 1988. Inversioneventsin the HSV-1 genomearedirectly

mediated by the viral replication machinery and lack sequence

specificity. Cell 54:369-381.

59. Weber,P. C.,M. Levine, and J. C. Glorioso. 1990.

Recombino-genic properties ofherpes simplexvirus type 1 DNA sequences resident in simian virus 40minichromosomes. J. Virol. 64:300-306. 60. Wildy,P.1955. Recombination with herpes simplex virus. J. Gen.

Microbiol. 13:346-360.

61. Wohlrab, F., S. Chatterjee, and R. D. Wells. 1991. The herpes simplexvirus 1 segmentinversion site isspecifically cleaved bya virus-induced nuclear endonuclease. Proc. Natl. Acad. Sci. USA 88:6432-6436.

62. Wohlrab, F.,M.J. McLean,and R.D. Wells. 1987. The segment inversion site ofherpessimplex virus type 1 adoptsanovelDNA structure.J.Biol. Chem.262:6407-6416.

63. Wohlrab,F.,and R.D. Wells. 1989. Slightchanges in conditions influence thefamilyof non-B-DNA conformations of theherpes

simplex virus type 1 DR2 repeats. J. Biol. Chem. 264:8207-8213. 64. Yuan, L.-W., and R. L. Keil. 1990. Distance-independence of

mitoticintrachromosomal recombination in Saccharomyces cerevi-siae. Genetics124:263-273.

on November 9, 2019 by guest

http://jvi.asm.org/