• No results found

[PDF] Top 20 Replication and Pathogenicity of Primer Binding Site Mutants of SL3-3 Murine Leukemia Viruses

Has 10000 "Replication and Pathogenicity of Primer Binding Site Mutants of SL3-3 Murine Leukemia Viruses" found on our website. Below are the top 20 most common "Replication and Pathogenicity of Primer Binding Site Mutants of SL3-3 Murine Leukemia Viruses".

Replication and Pathogenicity of Primer Binding Site Mutants of SL3-3 Murine Leukemia Viruses

Replication and Pathogenicity of Primer Binding Site Mutants of SL3-3 Murine Leukemia Viruses

... The viruses were derived from a pBR328 subclone of lSL3-95 (19), T464, containing a functional SL3-3 provirus surrounded by sequences of genomic ...Three SL3-3 replication-compe- ... See full document

6

The Kissing-Loop Motif Is a Preferred Site of 5′ Leader Recombination during Replication of SL3-3 Murine Leukemia Viruses in Mice

The Kissing-Loop Motif Is a Preferred Site of 5′ Leader Recombination during Replication of SL3-3 Murine Leukemia Viruses in Mice

... by SL3-3 murine leukemia virus (MLV) and three primer binding site mutants thereof ...the primer binding site, and the upstream part of the 5 ⴕ ... See full document

5

Stability of AML1 (core) site enhancer mutations in T lymphomas induced by attenuated SL3-3 murine leukemia virus mutants.

Stability of AML1 (core) site enhancer mutations in T lymphomas induced by attenuated SL3-3 murine leukemia virus mutants.

... retrovirus SL3-3 is highly T ...to binding sites for the AML1 transcrip- tion factor family (also known as the core binding factor [CBF], polyomavirus enhancer binding protein 2 ... See full document

8

Increased lymphomagenicity and restored disease specificity of AML1 site (core) mutant SL3-3 murine leukemia virus by a second-site enhancer variant evolved in vivo.

Increased lymphomagenicity and restored disease specificity of AML1 site (core) mutant SL3-3 murine leukemia virus by a second-site enhancer variant evolved in vivo.

... of SL3-3 significantly reduces the pathogenicity of the ...of viruses with altered enhancers in tumors does not necessarily mean that such vari- ants contributed to ...a murine tumor ... See full document

8

Placement of tRNA primer on the primer-binding site requires pol gene expression in avian but not murine retroviruses.

Placement of tRNA primer on the primer-binding site requires pol gene expression in avian but not murine retroviruses.

... The primer for this synthetic event is a molecule of cellular tRNA, which is annealed by its 3 * 18 nucleotides to a region of the genomic RNA termed the primer-binding site (PBS); the ... See full document

7

Increased Induction of Osteopetrosis, but Unaltered Lymphomagenicity, by Murine Leukemia Virus SL3-3 after Mutation of a Nuclear Factor 1 Site in the Enhancer

Increased Induction of Osteopetrosis, but Unaltered Lymphomagenicity, by Murine Leukemia Virus SL3-3 after Mutation of a Nuclear Factor 1 Site in the Enhancer

... a murine leukemia virus which is only weakly bone pathogenic but highly T-cell ...factor binding sites, among which are three identical sites for nuclear factor 1 ...NF1 site enhancer ... See full document

10

Characterization of the Block in Replication of Nucleocapsid Protein Zinc Finger Mutants from Moloney Murine Leukemia Virus

Characterization of the Block in Replication of Nucleocapsid Protein Zinc Finger Mutants from Moloney Murine Leukemia Virus

... structure. Primer tRNA placement on the viral genome and the ability of the tRNA to function in reverse transcription initiation in vitro also appear ...CCHH mutants produced these DNA copies at greatly ... See full document

11

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer.

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer.

... a primer for the viral reverse transcrip- tase (RT). The 3 9 end of the priming tRNA molecule is an- nealed to the primer-binding site (PBS), a complementary 18-bp sequence near the 5 9 ... See full document

5

Primer Binding Site-Dependent Restriction of Murine Leukemia Virus Requires HP1 Binding by TRIM28

Primer Binding Site-Dependent Restriction of Murine Leukemia Virus Requires HP1 Binding by TRIM28

... Murine leukemia viruses (MLVs) are unable to replicate in mouse embryonic carcinoma (EC) and embryonic stem (ES) cells (2, 6, 7, ...factor binding to the viral enhancers (9, 12) and in larger ... See full document

5

Importance of a c-Myb binding site for lymphomagenesis by the retrovirus SL3-3.

Importance of a c-Myb binding site for lymphomagenesis by the retrovirus SL3-3.

... All murine leukemia viruses (MuLVs) and related type C retroviruses contain a highly conserved binding site for the Ets family of transcription factors within the enhancer sequences in ... See full document

7

Second-site proviral enhancer alterations in lymphomas induced by enhancer mutants of SL3-3 murine leukemia virus: negative effect of nuclear factor 1 binding site.

Second-site proviral enhancer alterations in lymphomas induced by enhancer mutants of SL3-3 murine leukemia virus: negative effect of nuclear factor 1 binding site.

... regarding SL3-3 (40) and other MLVs (7, 61). Pro- viruses with variations in the number of repeat elements are generally found in more than half of the examined murine tumors induced by ... See full document

11

Second-Site Changes Affect Viability of Amphotropic/Ecotropic Chimeric Enveloped Murine Leukemia Viruses

Second-Site Changes Affect Viability of Amphotropic/Ecotropic Chimeric Enveloped Murine Leukemia Viruses

... second- site changes occur within SU, second-site changes within TM have the potential to improve SU-TM interactions (interaction C in ...(Table 3). This suggests that for the AE7 viruses, a ... See full document

15

Sequences between the Enhancer and Promoter in the Long Terminal Repeat Affect Murine Leukemia Virus Pathogenicity and Replication in the Thymus

Sequences between the Enhancer and Promoter in the Long Terminal Repeat Affect Murine Leukemia Virus Pathogenicity and Replication in the Thymus

... Because we had detected two different populations of DDEN virus, we wished to determine whether reversions or secondary mutations in the LTR could account for their dif- ferent abilities to replicate in the thymus. To ... See full document

9

Localization of the leukemogenic determinants of SL3-3, an ecotropic, XC-positive murine leukemia virus of AKR mouse origin.

Localization of the leukemogenic determinants of SL3-3, an ecotropic, XC-positive murine leukemia virus of AKR mouse origin.

... We localized the primary leukemogenic determinant to a 3.8-kilobase fragment of the SL3-3 genome containing the viral long terminal repeat, 5' untranslated sequences, gag gene, and 5', 3[r] ... See full document

12

Leader Sequences Downstream of the Primer Binding Site Are Important for Efficient Replication of Simian Immunodeficiency Virus

Leader Sequences Downstream of the Primer Binding Site Are Important for Efficient Replication of Simian Immunodeficiency Virus

... the primer binding site (PBS) of ...while viruses containing deletions of 21 nt ( ⴙ 398 to ⴙ 418) (construct SD2) or 53 nt ( ⴙ 345 to ⴙ 397) (construct SD3) displayed diminished capacity in ... See full document

7

Origin of the minor glycoproteins of murine leukemia viruses.

Origin of the minor glycoproteins of murine leukemia viruses.

... DISCUSSION We have investigated the origin of minor glycoproteins from R-MuLV and membranes of a thymic murine leukemia-derived lymphoblastoid cell line which are chemically and antigeni[r] ... See full document

11

Genomic Stability of Murine Leukemia Viruses Containing Insertions at the Env-3′ Untranslated Region Boundary

Genomic Stability of Murine Leukemia Viruses Containing Insertions at the Env-3′ Untranslated Region Boundary

... One deletion species arising by recombination between 7-bp direct repeats within the insert occurred in all IRES-GFP- containing vectors. Notably, while sequence analysis revealed that the IRES-GFP cassette contains 77 ... See full document

10

Interactions of Murine APOBEC3 and Human APOBEC3G with Murine Leukemia Viruses

Interactions of Murine APOBEC3 and Human APOBEC3G with Murine Leukemia Viruses

... AAAGCCTGAACTCACCGCGACGTC 3⬘) and hph 3030R (5⬘ CACGAGTG CTGGGGCGTCGGTTTC 3⬘) by using Pfu Turbo polymerase (Stratagene) for 20 to 30 cycles under the following PCR conditions: 95°C, 30 s; ... See full document

10

Effects of alterations of primer-binding site sequences on human immunodeficiency virus type 1 replication.

Effects of alterations of primer-binding site sequences on human immunodeficiency virus type 1 replication.

... During early stages of infection, the two PBS mutants, in conjunction with tRNA1Ls and tRNAPhe, appar- An early, critical step in the human immunodeficiency virus type HIV-1 life cycle i[r] ... See full document

9

Stem cell factor binding to retrovirus primer binding site silencers.

Stem cell factor binding to retrovirus primer binding site silencers.

... Moloney murine leukemia virus (M- MuLV) infects EC cells with extremely low efficiency (3, 10–12, 15), while differentiated cell lines such as 3T3 fibroblasts are readily infected by M-MuLV ... See full document

8

Show all 10000 documents...