• No results found

[PDF] Top 20 Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA

Has 10000 "Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" found on our website. Below are the top 20 most common "Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA".

Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA

Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA

... (sense) 5 ’ -GCCAAAATTCGCAGTCCC-3 ’ , 0.5 μ M pri- mer hbv460 (antisense) 5’-GATAGTCCAGAAGAAC- CAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the 5’ ... See full document

6

Development of a new ultra sensitive real time PCR assay (ultra sensitive RTQ PCR) for the quantification of HBV DNA

Development of a new ultra sensitive real time PCR assay (ultra sensitive RTQ PCR) for the quantification of HBV DNA

... a new ultra sensitive in-house RTQ-PCR performed in a LightCycler® ...The new assay showed improved sensitivity of 22 and 8 IU/mL as 95% and 50% detection end-points, ... See full document

6

Characterization of a New Sensitive PCR Assay for Quantification of Viral DNA Isolated from Patients with Hepatitis B Virus Infections

Characterization of a New Sensitive PCR Assay for Quantification of Viral DNA Isolated from Patients with Hepatitis B Virus Infections

... accurate quantification of hepatitis B virus (HBV) DNA is necessary for monitoring patients with chronic hepatitis receiving antiviral therapy in order to determine treatment response and to adapt ... See full document

6

COBAS AmpliPrep COBAS TaqMan Hepatitis B Virus (HBV) Test: a Novel Automated Real Time PCR Assay for Quantification of HBV DNA in Plasma

COBAS AmpliPrep COBAS TaqMan Hepatitis B Virus (HBV) Test: a Novel Automated Real Time PCR Assay for Quantification of HBV DNA in Plasma

... highly sensitive PCR-based assays for hepatitis B virus (HBV) ...reliable PCR results depend on ...for HBV DNA extraction and real-time PCR ... See full document

7

Development and Assessment of a Multiplex Real Time PCR Assay for Quantification of Human Immunodeficiency Virus Type 1 DNA

Development and Assessment of a Multiplex Real Time PCR Assay for Quantification of Human Immunodeficiency Virus Type 1 DNA

... RTMP. PCR was optimized using two sets of primers and molecular beacon probes labeled with two different dyes for the amplification and detection of HIV-1 and CCR5 ...HIV-1 DNA [single- stranded DNA ... See full document

6

A Genotype Independent Real Time PCR Assay for Quantification of Hepatitis B Virus DNA

A Genotype Independent Real Time PCR Assay for Quantification of Hepatitis B Virus DNA

... Accurate quantification of hepatitis B virus (HBV) DNA levels is important for monitoring patients with chronic HBV infection and for assessing their responses to antiviral ...a ... See full document

6

Validation of a pan orthopox real time PCR assay for the detection and quantification of viral genomes from nonhuman primate blood

Validation of a pan orthopox real time PCR assay for the detection and quantification of viral genomes from nonhuman primate blood

... of new drugs under the FDA ’s accelerated approval mechanism, such as the influenza vaccines Fluad and ...plaque assay method(s) and polymerase chain reaction (PCR) analysis by agarose gel ... See full document

9

Quantification of Hepatitis Delta Virus RNA in Serum by Consensus Real Time PCR Indicates Different Patterns of Virological Response to Interferon Therapy in Chronically Infected Patients

Quantification of Hepatitis Delta Virus RNA in Serum by Consensus Real Time PCR Indicates Different Patterns of Virological Response to Interferon Therapy in Chronically Infected Patients

... the assay. Among these samples, 5 were positive for the HBV surface antigen and HBV DNA ...the HBV surface antigen but positive for either hepatitis C virus (HCV) RNA ...RT-PCR ... See full document

7

Development and Application of Real Time PCR Assay for Quantification of Mycobacterium ulcerans DNA

Development and Application of Real Time PCR Assay for Quantification of Mycobacterium ulcerans DNA

... the development of a real-time PCR method for the quantification of ...ulcerans DNA (IS2404 TaqMan). The highly specific assay is based on the detection of the ...TaqMan ... See full document

7

New Highly Sensitive Real Time PCR Assay for HIV 2 Group A and Group B DNA Quantification

New Highly Sensitive Real Time PCR Assay for HIV 2 Group A and Group B DNA Quantification

... HIV-2 DNA quantification ...total DNA was extracted from 200 ␮ l using NucleoSpin blood kits (Macherey-Nagel, Düren, Germany) in labs A and B (Necker Hospital, Paris, and Charles Nicolle Hospital, Rouen, ... See full document

8

A highly sensitive, non invasive qPCR based strategy for direct quantification of Yersinia ruckeri in fish faeces

A highly sensitive, non invasive qPCR based strategy for direct quantification of Yersinia ruckeri in fish faeces

... Pontiroli, A., Travis, E.R., Sweeney, F.P., Porter, D., Gaze, W.H., Mason, S., Hibberd, V., Holden, J., Courtenay, O. & Wellington, E.M.H. (2011) Pathogen quantitation in complex matrices: a multi- operator ... See full document

20

Real Time PCR for Detection and Differentiation of Entamoeba histolytica and Entamoeba dispar in Fecal Samples

Real Time PCR for Detection and Differentiation of Entamoeba histolytica and Entamoeba dispar in Fecal Samples

... of PCR with Entamoeba ...of PCR (Table 2). DNA was extracted from 181 fecal samples, which were collected during a study in Durban, South ...with PCR revealed a good concordance between ... See full document

5

High occurrence of Blastocystis sp  subtypes 1–3 and Giardia intestinalis assemblage B among patients in Zanzibar, Tanzania

High occurrence of Blastocystis sp subtypes 1–3 and Giardia intestinalis assemblage B among patients in Zanzibar, Tanzania

... In the subtype analysis, ST1 was the most commonly found subtype, followed by ST2 and ST3, with a rather even distribution between these three subtypes. No mixed infections were detected. A higher prevalence of mixed ... See full document

12

Simultaneous Detection, Subgrouping, and Quantitation of Respiratory Syncytial Virus A and B by Real Time PCR

Simultaneous Detection, Subgrouping, and Quantitation of Respiratory Syncytial Virus A and B by Real Time PCR

... Design of primer-probe pairs. The assay was designed to serve two purposes: (i) detection of a broad range of RSV strains and (ii) differentiation of RSV subgroups A and B. The N gene of RSV was chosen as the ... See full document

6

Sensitive and high throughput quantification of abscisic acid based on quantitative real time immuno-PCR

Sensitive and high throughput quantification of abscisic acid based on quantitative real time immuno-PCR

... of PCR tube and anti-ABA McAb, we detected the protein amount in washing buffer, including TBS (tris-buffered saline, ...of PCR tube with glutaraldehyde before antibody coating was a recommended measure in ... See full document

10

Development of a duplex TaqMan real time RT PCR assay for simultaneous detection of newly emerged H5N6 influenza viruses

Development of a duplex TaqMan real time RT PCR assay for simultaneous detection of newly emerged H5N6 influenza viruses

... According to a report from the World Organization for Animal Health (OIE), the initially described outbreaks in poultry caused by an H5N6 HPAIV were in China and Lao People’s Democratic Republic in early May 2014 [23]. ... See full document

7

Automated Extraction and Quantification of Human Cytomegalovirus DNA in Whole Blood by Real Time PCR Assay

Automated Extraction and Quantification of Human Cytomegalovirus DNA in Whole Blood by Real Time PCR Assay

... HCMV DNA was detected and quantified with the Light Cycler system ...(phosphate)-3⬘. Real-time PCR was carried out with the Fast Start DNA master hybridization probes (Roche Molecular ... See full document

6

Comparison of a New Quantitative ompA Based Real Time PCR TaqMan Assay for Detection of Chlamydia pneumoniae DNA in Respiratory Specimens with Four Conventional PCR Assays

Comparison of a New Quantitative ompA Based Real Time PCR TaqMan Assay for Detection of Chlamydia pneumoniae DNA in Respiratory Specimens with Four Conventional PCR Assays

... for quantification and unknown samples (tested four times each) matched with one no-template control and one ENC for each clinical sample ...the PCR product were performed with an ABI Prism 7700 sequence ... See full document

9

Improved Safety for Molecular Diagnosis of Classical Rabies Viruses by Use of a TaqMan Real Time Reverse Transcription PCR “Double Check” Strategy

Improved Safety for Molecular Diagnosis of Classical Rabies Viruses by Use of a TaqMan Real Time Reverse Transcription PCR “Double Check” Strategy

... ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was ...developed assay and a previously described one had some detection ...combined assay that detected ... See full document

9

A sensitive quantification of HHV-6B by real-time PCR

A sensitive quantification of HHV-6B by real-time PCR

... In 1986, a novel virus was isolated from six immunocompromised patients by Salahuddin and co-workers and was denoted Human B-lymphotropic virus (HBLV) due to their capability to infect B cells (1). HBLV was shown to ... See full document

6

Show all 10000 documents...